Kommentarer: 234
16. januar, 2012

Sigve Brekke

Sigve Brekke (1985) er lærer og student

Skaper tabu

Er det problematisk å tro på intelligent design og samtidig undervise i naturfag? Kronikkforfatteren ble konfrontert med sine overbevisninger ved ansettelse i videregående skole.  

En kinesisk paleontolog sa: ”Det er hevdet at man i Kina kan kritisere Darwin, men ikke staten. I vesten kan man kritisere staten, men ikke Darwin uten at det kan få konsekvenser”.

Evolusjon har blitt et følelsesladd tema i kretser som ellers tror sterkt på fornuften. I Norge har vi stor aksept for religioner, men dersom folk faktisk tror på en skaper, med alt det innebærer, blir mange straks mer mistenksomme.

Høsten 2011 søkte jeg på en fast stilling på videregående skole, etter snart 7 år med studier. Undervisningsstillingen omfattet kroppsøving, matematikk og naturfag. Noen dager etter den muntlige bekreftelsen om at jeg hadde fått stillingen, kom en telefon fra rektor. Han lurte på hvorfor jeg ikke hadde snakket om intelligent design (ikke kreasjonisme) på intervjuet. Da svarte jeg at det ikke var relevant for jobben som jeg skulle utføre, og sendte samtidig en epost med et forsvar for min personlige overbevisning.

I eposten argumenterte jeg blant annet for at den biologiske informasjonen som finnes i naturen peker på en skaper, fordi man vet fra erfaring at informasjon har et intelligent opphav.

Mikro-, ikke makroevolusjon
Dermed tror jeg ikke på makroevolusjon, det vil si store endringer i den biologisk programmerte informasjonen (DNA) som kan spores til et universelt opphav betegnet som en ”urcelle”.

Mikroevolusjon har jeg derimot ingen betenkeligheter med. Dette innebærer naturlig seleksjon som virker på tilfeldig variasjon/mutasjoner og som dermed gir små miljøtilpasninger over tid.

Når disse darwinistiske mekanismene brukes til å forklare makroevolusjon, kaller jeg det ”ateistisk filosofi”. Dette fant skolen ut ved å google meg.

Det er ikke nytt at religiøse mennesker tror på en skaper. Faktisk tror mange på både Gud og biologisk evolusjon, men kanskje de aldri har fått høre motargumentene som intelligent design-bevegelsen fremholder.

Med intelligent design kan man argumentere for at livet er skapt uten å referere til hellige skrifter. Troen på en skaper er fremstilt som ufornuftig blant vitenskapsmenn, mens evolusjon er fornuftig.

En ateist tror at man kommer fra ingenting, av ingenting og for ingenting, i den grad det er fornuftig. Noen hevder naturlovene var der først, men naturlover er noe, ikke ingenting. Kristne kan argumentere for at designeren er evig og ikke materiell. Siden skaperen ikke er av materie og aldri har kommet inn i tilværelsen trenger ikke Gud en årsaksforklaring.

Slike rasjonelle argumenter for en designer oppfattes tydeligvis som mer truende enn religiøse tekster som på forhånd kan avskrives som ufornuftige.

Kristne må ligge lavt
I skolen kan pedagoger undervise om islam uten å tro på Koranen, mens det oppfattes som relevant at man tror på evolusjon for å kunne undervise i naturfag. I fremtiden kan ansettelser av pedagoger i naturfag føre til en utsilingsprosess i det stille. Spørsmålet er om dette er et demokratisk samfunn verdig.

Norge har lang tradisjon for å håndtere interne spenninger grunnet religion eller politiske meninger, men hva med de nye fremvoksende kontroversene som utfordrer innarbeide sannheter i samfunnet?

Evolusjonsteorien (etablert forskningsprogram) var i sin tid kontroversiell fordi den hadde ateistiske implikasjoner. Intelligent design (fremvoksende forskningsprogram) har teistiske implikasjoner, noe som er upopulært hos mennesker som på forhånd har forkastet muligheten for at det finnes en skaper.

I praksis betyr denne hendelsen at kristne bør ligge lavt i terrenget i medier og på internett dersom de har meninger som utfordrer etablerte politiske og vitenskaplige sannheter. Selv har jeg som personlig kristen valgt ikke å være hyklerisk på internett og å stå opp for det jeg mener er sannheten.

I likhet med samfunnsborgere som er ”vitenskapelig korrekte” vil jeg ytre meg fritt i medier. Men dette kan altså ha konsekvenser, selv i et land som fremhever demokrati, religionsfrihet og ytringsfrihet som viktige verdier.

Jeg ville aldri brukt arbeidsplassen som en talerstol for mitt syn. Min stilling som pedagog er ikke å spre informasjon i klasserommet som enda ikke er allment kjent eller akseptert i samfunnet. Det er for øvrig vanlig i skolen å se en sak fra flere sider, men evolusjonsteorien har en annen status i dag — dessverre.

Derfor er det mer riktig å debattere intelligent design på arenaer som ikke angår en stilling som pedagog, men ideelt sett burde man også se på motargumentene og selv velge om man vil tror på en skaper eller en naturalistisk forklaring i dette spørsmålet.

Det tjener ikke vitenskapen at elevene læres opp til å godt etablerte sannheter ukritisk. Historien har vist at det nettopp er mennesker som forkaster etablerte sannheter som har sørget for vitenskaplige fremskritt.

Diskriminering i det stille
Jeg fikk jobbtilbudet. Noe annet ville vært brudd på norsk lov. Skolen på sin side måtte sannsynligvis håndtere en intern klage på ansettelsen og trengte dermed en bekreftelse på at jeg ikke hadde noen agenda i klasserommet.

Personlig skjønner jeg at skolen ønsket å beholde roen på arbeidsplassen i denne saken, men strengt tatt er det unødvendig. Hva om noen hadde googlet meg før intervjuet og funne ut hva jeg tror og står opp for? Jeg frykter en utvikling der man lar være å innkalle søker til intervju, dersom søker har ytret kontroversielle meninger på nett.

-       Sigve Brekke (1985) er lærer og student

Kommentarer: 234
  • Cassanders

    I eposten argumenterte jeg blant annet for at den biologiske informasjonen som finnes i naturen peker på en skaper, fordi man vet fra erfaring at informasjon har et intelligent opphav.

    Mikro-, ikke makroevolusjon
    Dermed tror jeg ikke på makroevolusjon, det vil si store endringer i den biologisk programmerte informasjonen (DNA) som kan spores til et universelt opphav betegnet som en ”urcelle”.

    Det er mulig at du har redegjort i større detalj i e-posten din, men her er det meste feilaktig.

    For det første er ikke din innledende premiss korrekt: Informasjon (også BIOLOGISK informasjon) finnes i naturen uten at det peker på en skaper.
    Du gir DIN PERSONLIGE overbevisning (om emipririen) almenn gyldighet.

    Mikroevolusjon har jeg derimot ingen betenkeligheter med. Dette innebærer naturlig seleksjon som virker på tilfeldig variasjon/mutasjoner og som dermed gir små miljøtilpasninger over tid.

    Det er sørgelig at du etter så mange års studier ikke har fått med deg den andre vesentlige forutsetningen for artsdannelse: (reproduktiv) isolasjon.

    For øvrig er din konklusjon ikke en nødvendig følge av din (til og med feilaktige) premiss. I tillegg til å være faktisk feil er det en altså en ugyldig logisk slutning.

    Når disse darwinistiske mekanismene brukes til å forklare makroevolusjon, kaller jeg det ”ateistisk filosofi”. Dette fant skolen ut ved å google meg

    Din vilje til å kalle en særdeles velbegrunnet vitenskapelig teori for ‘darwinisitisk filosofi’ sier atskillig om din evne til å være lærer i biologi. Jeg synes skolen har grunn til å være bekymret.

    Det er ikke problematisk å lære elever opp til å være kritiske, men det er høyst problematisk å lære dem «å være kritiske» ved å overse eller bortforklare viktige fakta.

    Dette er en oppskrift på utdanning som gjør fremtiden elever særdeles dårlig rustet til å skille mellom god og dårlige kunnskap, f.eks til å kunne gjenkjenne en konspirasjonsteori.

    Cassanders
    In Cod we trust

  • Sigve Brekke

    Du skriver: «For det første er ikke din innledende premiss korrekt: Informasjon (også BIOLOGISK informasjon) finnes i naturen uten at det peker på en skaper.
    Du gir DIN PERSONLIGE overbevisning (om emipririen) almenn gyldighet.»

    Du må begrunne hvorfor premissen er feil. Gi meg ett eksempel på informasjon som beviselig ikke har en intelligent kilde.

  • Cassanders

    @Sigve Brekke
    …Dembski 1999? :-)
    Du finner en kort gjennomgang på Talkorigins:
    http://www.talkorigins.org/indexcc/CI/CI010.html

    Det kan bemerkes at en del av argumentene på T.O.A. anvender «standard lærebok -fysikk» altså for enkelthets skyld viser til fysiske lover under «standard»-betingelser, ideelle gasser, osv.
    Dette er en konvensjonell forenkling som gjør det enklere å forholde seg til vanlig lærebokstoff.

    Men det kan være verd å huske at biologiske enheter -f.eks en hvilket som helst organisme ikke er et LUKKET system (i balanse), men tvert i mot et ÅPENT termodynamisk system. Det er et system som opprettholder sin negative entropi (=orden) på bekostning av omgivelsene. (Det må forbruke energi, og øker derved entropien i verden rundt seg).
    Til og med virus som ikke har noen egen metabolisme følger dette prinsipet. Energien som skal til for å skape orden (minske entropien) hentes fra metabolismen til cellen den har infisert.

    Cassanders
    In Cod we trust

  • Øyvind

    «Intelligent design (fremvoksende forskningsprogram) har teistiske implikasjoner, noe som er upopulært hos mennesker som på forhånd har forkastet muligheten for at det finnes en skaper.»
    Nei, det er «upopulært» for at det ikke forholder seg til vitenskap.

    Å undervise ID i naturfag er som å lære bort at 2+2=5 i matematikk. At slikt nonsens tillates i skolen er en skam for et moderne land.

  • arild nordby

    Makro-evolusjon er ingenting annet enn ørten steg av mikro-evolusjon.
    Har du ikke skjønt det, Sigve?

  • http://karsteneig.no Karsten Eig

    Brekke har et godt poeng: Hans religiøse – for det er det det er – overbevisning bør ikke være til hinder for en lærerjobb, så lenge han holder seg til pensum i klasserommet. Vi skal ikke ha tankepoliti i Norge.

    Men ID i seg selv er ikke noe annet en det gamle «gud-i-hullene-argumentet», ikledd et tynt slør av kvasivitenskapelig retorikk.

    Makroveolusjon er ikke noe annet enn mikroevolusjon som får pågå lenge nok til at akkumulerte forskjeller blir tydelige.

    Informasjon i biologiske systemer er heller ikke noe annet enn kjemiske stofer og deres reaksjoner, styrt av naturlover. Det er selvsagt et interessant spørsmål hvor naturlovene kom fra, hvorfor Big Bang skjedde. Mange teister bruker dette til å implisere en ekstern årsak for universet, dvs Gud. Men ettersom vi ikke vet hvordan eller hvorfor Big bang skjedde, vet vi heller ikke at det må ha vært en ekstern årsak, og dette koker derfor ned til et filosofisk «begging the question».

    Brekkes artikkel har en, ikke eksplisitt, men implisitt, konspiratorisk undertone av at ID undertrykkes. Jeg har skrevet litt om hvorfor kvasivitenskap ofte er nødt til å trekke inn konspirasjonsteorier her: http://karsteneig.no/?p=147

    Men ID «undertrykkes» rett og slett fordi den ikke har vitenskapelig støtte.

  • Doremus

    «En ateist tror at man kommer fra ingenting, av ingenting og for ingenting, i den grad det er fornuftig. »

    Jeg registerer med betydelig glede at RLE ikke er blant fagene du skal undervise i.

    «Siden skaperen ikke er av materie og aldri har kommet inn i tilværelsen trenger ikke Gud en årsaksforklaring.»

    Så fint da. Da trenger formodentlig heller ikke de immaterielle naturlovene noen årsaksforklaring?

    «Spørsmålet er om dette er et demokratisk samfunn verdig.»

    Siden det eneste du har vist til i din fortelling er at man spurte deg om hvorvidt du ville undervise i det som regnes som veldokumenterte vitenskapelige teorier til tross for at du er sterkt uenig i dem, tror jeg nok at alle vi demokrater kan sove trygt om natten inntil videre.

    Jeg synes analogien til Islam er god – ja, man kan utmerket godt undervise om islam uten å være enig i den, men hvis en lærer har gitt utrykk for sterk kritikk og tildels karikerìng av islam, er det svært rimelig å ønske å sjekke hvordan dette evt. vil påvirke hans lærergjerning.

    «Det er for øvrig vanlig i skolen å se en sak fra flere sider, men evolusjonsteorien har en annen status i dag — dessverre.»

    Det er mulig at seks år med SV-statsråd har endret den norske skolen radikalt, men i min tid var det definitivt ikke vanlig å se veletablerte vitenskapelige teorier «fra flere sider», enten det dreide seg om evolusjon, Newtons lover, eller atomteori.

  • Sigve Brekke

    Til Kasten:

    Du skriver «Men ID i seg selv er ikke noe annet en det gamle “gud-i-hullene-argumentet”, ikledd et tynt slør av kvasivitenskapelig retorikk.»

    Dette utsagnet viser at du ikke har forstått mitt Gudsbilde. Dersom du ser en bil tar du det som selvsakt at det står en intelligent bak, men selv om du plukker bilens deler i fra hverandre slutter du ikke å tro at det står en intelligent bak. Jeg blir begeistrett over guds kreativitet i økende grad når kunnskapen om skaperverket øker. Gud blir ikke mindre, men inponerer meg desot mer. Jeg har altså ikke et «God in the gap Guds» bilde.Darwinister har forøvrig snart slutte å bruke søppel DNA som bevis på evolusjon. Det er et eksempel på darwin in the gap.

  • Sigve Brekke
  • Enda en kommentar

    Sigve: «Intelligent design (fremvoksende forskningsprogram) har teistiske implikasjoner, noe som er upopulært hos mennesker som på forhånd har forkastet muligheten for at det finnes en skaper.»

    Øyvind: «Nei, det er “upopulært” for at det ikke forholder seg til vitenskap.»

    Nå er det også en stor del vitenskapsfolk som tror på ID, så uvitenskaplig stemmer ikke. Også i mange andre vitenskaper finnes divergerende syn på ulike temaer uten at noen stemples som uvitenskaplige. Slik stempling forsøpler saklig debatten og gjør det vanskeligere å fremsette de kontradiksjoner til vitenskaplige hypoteser. Slike kontradiksjoner trengs hvis vitenskap skal ha framgang. Alternativet er ensporethet med risiko for feil og som Sigve antyder: misbruk av vitenskaplige dogma til livssynsmessig ensretting i undervisningsinstitusjoner.

    Øyvind: «Å undervise ID i naturfag er som å lære bort at 2+2=5 i matematikk. At slikt nonsens tillates i skolen er en skam for et moderne land.»

    Er det en skam at det undervises i islam, hinduisme, buddhisme og animisme også?

    Etter min mening bør det undervises i alle de store religionene og livssynene av hensyn til almennopplysning uavhengig av hva man selv mener er riktig. Det samme gjelder mange omstidte tema, f.eks. evolusjonsteori/ID. Så får folk selv ta stilling til dem på eget grunnlag. Da får elevene også innsikt til å kritisere et livssyn og livsynsrelaterte argumenter/teorier på grunnlag av det folk virkelig tror på i stedet for å kritisere et livssyn basert på egne fordommer. For påstanden om at 2+2=5 er sammenlignbart med påstander i ID, vil nok ingen tilhengere av ID vedkjenne seg. De vil heller si det er en fordom.

    Arild Nordby: «Makro-evolusjon er ingenting annet enn ørten steg av mikro-evolusjon.
    Har du ikke skjønt det, Sigve?»

    Nettopp dette er et av de viktigste stridstemaene. Du kan nok kaste fram en del slike påstander, uten at de overbeviser dine motparter. For de har sine begrunnelser for det motsatte og de er ikke religiøse.

    Det er etter mitt skjønn bedre om man tar Sigves hjertesukk om toleranse på dette temaet mer alvorlig. Det betyr at man må la noen ytre slike påstander i skolen selv om man tror de er feil. Alternativet er nemlig livssynsdiskriminering i undervisningsinstitusjoner. Det er som kjent ikke slikt et demokrati vil være bekjent av.

  • http://karsteneig.no Karsten Eig

    Dersom du ser en bil tar du det som selvsakt at det står en intelligent bak, men selv om du plukker bilens deler i fra hverandre slutter du ikke å tro at det står en intelligent bak.

    Nei, og so what? Vi vet at biler er laget av bilfabrikker, fordi vi observerer bilfabrikkene. Gud er derimot ikke observert, og det foreligger ikke data om livet som tilsier at det må stå en slik mekaniker bak.

    Jeg blir begeistrett over guds kreativitet i økende grad når kunnskapen om skaperverket øker. Gud blir ikke mindre, men inponerer meg desot mer.

    Helt greit det, jeg sier ikke at kunnskap nødvendigvis må stå i motseting til gudstro. Men det foreligger ikke kunnskap som du kan bruke som et gudsbevis.

    Jeg har altså ikke et “God in the gap Guds” bilde.

    Jo, det har du, fordi ID pr definisjon bruker Gud som en forklaring på fenomener vi pr i dag ikke har et svar på. Om du setter guden inn som forklaring på et vitenskapelig problem er det en gud i hullene, uansett om dette er et påståt hull i informasjon eller et reelt hull i vår kunnskap om Big Bang.

    Darwinister har forøvrig snart slutte å bruke søppel DNA som bevis på evolusjon.

    Hvorfor trekker du inn dette, sånn helt på tampen av innlegget? Forøvrig en påstand som du bør belegge.

  • http://karsteneig.no Karsten Eig

    @Enda en kommentar:

    Øyvind: “Å undervise ID i naturfag er som å lære bort at 2+2=5 i matematikk. At slikt nonsens tillates i skolen er en skam for et moderne land.”

    Er det en skam at det undervises i islam, hinduisme, buddhisme og animisme også?

    Det bør gis en god deskriptiv undervising i alle religioner. ID kan også ha en plass i filosofi eller vitenskapsundervising, som eksempel på påstander som bør underkastes kritisk tenkning. Men man bør ikke late som det er en reell vitenskapelig kontrovers rundt det; ID er først og fremst et resultat av amerikanske kreasjonisters strategi for å fremstå mer vitenskapelige for å omgå den amerikanske grunnlovens skille mellom stat og kirke, og dermed mellom religion og vitenskap i undervisingen.

    Det samme gjelder mange omstidte tema, f.eks. evolusjonsteori/ID. Så får folk selv ta stilling til dem på eget grunnlag.

    ID og evolusjon er IKKE vitenskapelig omstridt. Det er bare ID-tilhengerne som ønsker å fremstille det slik for å kunne skrike «teach the controversy» – en kontrovers ID-tilhengerne inviterte til, men der knapt noen andre forskere møtte opp. Den eneste måten å få dette til å bli en kontrovers er å inta et postmodernistisk vitenskapsrelativistisk standpunkt der alle påstander er like gyldige fordi noen fremsetter dem.

    «Folk selv» er ikke forskere med kunnskap om biologi, geologi, astronomi, fysikk etc. Derfor har de heller ikke grunnlag for å selv ta kvalifisert stilling.

  • Kris

    Av samme grunn som jeg ikke ville ansatt en tonedøv musikklærer, en satanistisk eller ateistisk prest, en dogmatisk filosof eller en nazistisk krigshistoriker, så ville jeg ikke vurdert å ansette en kreasjonist som naturfagslærer.

    Kunne muligens akseptert en slik pedagog innen kroppsøving eller kunst og håndverk, men om mine barn hadde fått deg, Sigve, som lærer i naturfag, ville jeg gjort alt som var innenfor min makt for å få deg bort fra det klasserommet.

    Det er for all del mulig at du hadde kunnet undervise på samme måte som en mer fornuftig person (les: som aksepterer den vitenskapelige metode), men risikoen for religiøs vanvidd i et barnesinn er en risiko jeg ikke ønsker å utsette mine barn for.

    Er det forståelig..?

  • Kristoffer

    Tja…vil du kalle det diskriminering om man ikke ansetter en tannlege som mener fluor ikke styrker tennene?

  • http://karsteneig.no Karsten Eig

    Forøvrig: Please, slutt å bruke uttrykket «Darwinisme». Ordet brukes ikke av forskere, og bruken av det er et semantisk fingeravtrykk for kreasjonister. Darwin var ikke den første med tanker om utvikling, selv om han var den første som publiserte en koherent teori om hvordan det kunne skje. Hans landsmann Alrer Russell Wallace kom imidlertid frem til dette samtidig, men tapte på publiseringsmålstreken. Evolusjonsteorien og bevisene for evolusjon er utviklet enormt siden Darwin

  • http://www.geeljire09.wordpress.com Mohamed

    Sigve Brekke:

    Kort sagt: For all del fortell om (jeg ville ikke kalt det å undervise) ID, men ikke fortell elevene at det er vitenskap eller fakta. Det er mytologi.

    Det som styrker evolusjonsteorien er at det er en vitenskapelig teori som har et særdeles godt grunnlag. Det at det er en teori betyr ikke at det ikke kan være vitenskapelig fakta. Det betyr enkelt sagt at det «åpnes» for at det kan forkastes hvis man kommer med noe bedre – vitenskapelig sett. Dette er den grunnleggende forskjellen på viten og troen. I tro så handler det om å bevise troen (for eks: ID som du sier beviser at det finnes skaper), mens viten handler om etterprøvbarhet og falsifikasjon.

    Jeg anbefaler deg for øvrig denne boka her som er skrevet av den amerikanske biologiprofessoren Jerry Coyne: http://www.amazon.com/Why-Evolution-True-Jerry-Coyne/dp/0670020532

    Boka er en fin innføring i temaet.

    Her er link til Coynes personlige blogg: http://whyevolutionistrue.wordpress.com/

  • http://www.geeljire09.wordpress.com Mohamed

    Darwinisme er tullete begrep. Brukere av begrepet hentyder at det er noe «religiøst»/»livssyn» med å akseptere en vitenskapelig teori.

  • Sigve Brekke

    Til Karsten:

    Jeg liker ikke at andre tror at de kan bestemme hvilke gudsbilde jeg har, det vet jeg best selv. Hva er den beste forklaringen på biologisk informasjon? Tilfeldighet, tid og darwinistiske mekanismer eller en intelligent kilde. Da mener jeg det siste

    Appropo søppel DNA så brukte Dawkins dette som et bevis for evolusjon, men det har vist seg at det som man tidliggere kalte søppel DNA faktiske har nyttige funksjoner. For eksempel regulere produksjonen av proteiner. Darwinistene hadde ungen god forklaring på hvorfor noen DNA sekvenser ikke kodet for proteiner og lukket dermed øynene og sa det var skrap fre en lang utvikling ok, sa plaserte man Darwin in the Gap, jeg plasserer ikke God in the Gap, men idette tilfellet er intelligens den beste forklaringen.

  • Kris

    Om du virkelig er seriøs, Sigve, med at Intelligent Design/kreasjonisme er en god teori, og at (nesten) samtlige biologer siden Darwin altså har tatt feil, så er det jo fint om du adresserer selve saken, og ikke bare kommer med det kvasi-vitenskapelige møkket vi alle har hørt 1000 ganger før uten at det gjør noe særlig mer inntrykk.

    Det fine er jo, med vitenskap som sådan, at den gjør antagelser som må vise seg å stemme dersom teorien skal holde vann, så dersom du f.eks finner kaniner i prekambriske bergarter (som evolusjonsteorien antar at du *aldri* vil gjøre), eller elg i Australia fra en tidsperiode mennesket ikke har kunne frakte dem dit (igjen, det skal du ikke kunne finne i følge teorien om evolusjon) så har du plutselig noe relevant å komme med.

    Her har du en liste over empiriske bevis og antagelser som du selv kan teste:

    http://www.talkorigins.org/faqs/comdesc/

  • Stig

    Sigve, hva tror du tanken var bak da gud skapte kromosom 2 hos mennesker?

    http://en.wikipedia.org/wiki/Chromosome_2

  • http://www.geeljire09.wordpress.com Mohamed

    Enda en kommentar skrve: «Du kan nok kaste fram en del slike påstander, uten at de overbeviser dine motparter. For de har sine begrunnelser for det motsatte og de er ikke religiøse.»

    ———Dette er ikke helt riktig. Mesteparten av kreasjonismen/de kreasjonistiske argumentasjonsrekkene utspringer fra en eller annen grad av «religiøsitet» eller gudstro. Har det ikke falt deg inn hvorfor mange religiøse kreasjonister ikke kritiserer tyngdekraften eller atomteorien? Fordi det er først og fremst evolusjonsteorien (eller dette er deres forståelse) som utfordrer deres tro.

    Sigve Brekke kan pakke det inn og kalle det for «logiske» og «rasjonelle» argumenter, men det er fortsatt tro. Det blir ikke noe mer logisk av det. I verste fall så blir dette kvasivitenskap som flere andre har allerede nevnt.

    Du tar for øvrig feil når det kommer til det å overbevise kreasjonister. For en del år siden så ville jeg skrevet nesten det samme som Sigve Brekke gjør. De moderne religiøse apologistene (særlige kristne, muslimske og jødiske) har blitt mer sofistikert og pakker alt dette her inn «logikk» (det er relativt enkelt å gjennomskue det).

    Poenget er følgende: En eller annen gang så vil vi alle bli «frelst» (vitenskapelig sett) for å bruke et religiøst uttrykk. Det er ingenting som tilsier at Brekke ikke vil forandre standpunkt i framtiden. Husk det å tvile og det å skifte mening om noe er ikke en svakhet i seg selv. Det som er en svakhet er stahet og arroganse. Min mantra er relativ enkel: Hver eneste dag så er jeg villig til å skifte standpunkt. Hvis jeg blir presentert for gode, velfunderte og logiske argumenter. Dette handler ikke om «å vende kappen etter vinden» eller ikke å ha prinsipper, men et tegn på sunn fornuft og intellektuell redelighet. Noe som alle: religiøse og ikke-religiøse burde strebe etter.

  • Sigve Brekke

    Svar til Muhamed

    Jeg mener at du i din argumentasjon ikke er villig til å forstå ID for hva det er. Du pakker det inn i kreasjonisme, som bygger sine argumenter på Bibelen. ID bygger sine argumenter på observasjoner i naturen. Argumentasjon din er ugyldig fordi du karikerer en stråman.

    http://www.intelligentdesign.org/

    http://www.discovery.org/v/2

  • http://karsteneig.no Karsten Eig

    @Sigve: «If it walks like a duck, it talks like a duck, then it probably is a duck». Jeg har forøvrig ikke snakket om gudsbildet ditt, bare om argumentasjonen din.

    Informasjonen i biologien er ikke noe annet enn DNA, som er et kjemisk molekyl – stort, men dog et molekyl. Informasjonen i dette oppstår ved mutasjoner, og selve molekylet er utviklet over milliarder av år gjennom kjemiske reaksjoner. Informasjonen i molekylet er altså ikke noe som eksisterer på forhånd med
    DNA som bærer (som på fx en CD-plate), det er DNA-molekylet som er informasjonen. Følgelig trengs heller ikke en designergud.

    Om det viser seg at «søple-DNA» i noen tilfeller har nyttige funksjoner beviser ikke det annet enn at vitenskapen tar feil innimellom. Det er fortsatt mer enn nok søple-DNA igjen.

    http://en.wikipedia.org/wiki/Noncoding_DNA
    http://scienceblogs.com/pharyngula/2010/05/junk_dna_is_still_junk.php

  • Stig

    …og der er selveste essensen i det du ikke har forstått, Sigve: ID er *den direkte arvtageren* til kreasjonisme!

    Det er de samme menneskene som står bak som var beinharde kreasjonister før de var nødt til å endre ordlyden for at mølet i det hele tatt skulle ha en sjanse til å overleve et kritisk blikk av skolemyndighetene.

    Det er for dumt at du ikke har satt deg inn i denne delen, og forsåvidt kan jeg jo spørre deg:

    Hvem mener så du denne intelligente designeren er? Aliens? Zevs? Odin?

    Har du noensinne møtt noen ID-tilhengere som *ikke* mener den intelligente designeren er den kristne guden?

    Basert på svarene du gir på disse to spørsmålene: Kan du så stille deg et siste og endelig spørsmål: Hva er så forskjellen på kreasjonisme og intelligent design?

    Historien om Of Pandas and People er også kunnskap du bør tillære deg om du ikke er i stand til å skille mellom ID og kreasjonisme: http://en.wikipedia.org/wiki/Of_Pandas_and_People

  • Sigve Brekke

    Svar til Stig

    Her er en ateist som forsvarer ID for hva det er:

    http://www.youtube.com/watch?v=Et2VTJ1UBC4

    Hvem denne designeren er? Det sier ikke teorien noe om. Når vi kjøper en kake vet vi at den har et intelligent opphav uten at vi vet noe om personen.

    Kreasjonisme bygger på bibelen, ID studerer naturen. Da kommer man til at noen observasjoner i naturen best forklares ut fra et intelligent oppphav.

  • eirik

    «En kinesisk paleontolog sa: ”Det er hevdet at man i Kina kan kritisere Darwin, men ikke staten. I vesten kan man kritisere staten, men ikke Darwin uten at det kan få konsekvenser”.

    Det er et sunnhetstegn. Man må vel nesten være fra Kina hvis man finner det underlig..

    Det finnes overveldende bevis for evolusjon gjennom naturlig utvalg. Så hvis du velger leike leiken og kritisere Darwin (jeg antar du mener evolusjon), bør du også ta steiken og hoste opp bevis og argumenter. Hvis det beste du klarer å kaste frem er analogier til biler og båter er det desverre helt tydelig at du ikke er egnet til å lære fra deg noe om naturvitenskap, eller annen vitenskap for den slags skyld.

    Ville du ansatt en historielærer som ikke trodde på Holocaust?

    @ Mohamed:
    En «teori» i vitenskaplig terminologi betyr et sett med hypoteser med stor forklaringsevne, og som er støttet av så solide beviser at det er det nærmeste man kommer en vitenskaplig sannhet. (fra hukommelsen..)

    Litt forvirrende er det altså noe ganske annet enn ordet «teori» man bruker i dagligtalen, en ufundert antagelse.

  • eirik

    @ Sigve:

    Du vet at kaker og biler ikke formerer seg?..

  • eirik

    Evolusjon er ikke mer tabu enn at jorden er rund.

    Det er selvsagt ikke særlig intellligent å hevde at jorden er flat, og at evolusjon er løgn og fanteri fordi det egentlig er en magisk skaper som lagde dyr og mennesker fiks ferdig.

    Denne altomfattende livsløgnen din som har fått deg til å forkaste grunnleggende allmennkunnskap ut vinduet kan nok gjøre folk litt sosialt usikker rundt deg. Det er en naturlig konsekvens av ståstedet ditt.

  • Enda en kommentar

    @Mohamed:
    «Enda en kommentar skrve: “Du kan nok kaste fram en del slike påstander, uten at de overbeviser dine motparter. For de har sine begrunnelser for det motsatte og de er ikke religiøse.”

    –––Dette er ikke helt riktig. Mesteparten av kreasjonismen/de kreasjonistiske argumentasjonsrekkene utspringer fra en eller annen grad av “religiøsitet” eller gudstro. Har det ikke falt deg inn hvorfor mange religiøse kreasjonister ikke kritiserer tyngdekraften eller atomteorien? Fordi det er først og fremst evolusjonsteorien (eller dette er deres forståelse) som utfordrer deres tro. »

    Av og til lurer på om evolusjonsteorien satt i sosial kontekst blir en fordomsfylt religion.

  • Sigve Brekke

    Svar til Eirik

    De to siste reaksjonene dine kommenterer jeg ikke, men ditt første innlegg er legitimt. Jeg bruker biler og kaker som bilde på de poengene jeg vil få frem:) Et viktig poeng for ID er ikke reduserbare strukturer. I denne sammenhengen har flagellen blitt et symbol på dette. Et komplekst system må være inntakt fra bebynnelsen. Natyrlig seleksjon ville mest sannsynlig selektert bort havegse lemmer og organer eller cellelegemer for den slags skyld. Jeg mener derfor at livet først kom inn i tilværelsen før de darwinistiske mekanismene begynte å virke.

    http://www.youtube.com/watch?v=FnSxRYx82Gk&feature=related

    http://www.youtube.com/watch?v=VC_acwviSiA&feature=relmfu

  • Enda en kommentar

    @Karsten Eig: «ID og evolusjon er IKKE vitenskapelig omstridt.»

    Du er jammen morsom! :-D Kan du ikke lese at Sigve, meg og mange med oss er uenige med deg og dine meningsfeller? :-D

    Hvorfor tror du det finnes mange mennesker og en god del forskere som også tror på ID? Begrunnelsen imot er ikke religion, med vitenskaplige argumenter. Du kan gjerne påstå noe annet, men i så fall tillegger du dine meningsmotstandere usanne og fordomsfylte påstander! :-D Med slik virkelighetsoppfatning kan du få til mye underlig! :-D

  • Enda en kommentar

    @Cassanders: «In Cod we trust»

    Denne debattens største selvmål! :D «Cod»-argumentes hehehehe

  • http://karsteneig.no Karsten Eig

    @Sigve Brekke:

    Der kom flagellen, ja. Et skoleeksempel på gud-i-hullene-argument.

    I disse linkene har jeg gitt en grundig gjennomgang av de vanligste kreasjonist/ID-argumentene:
    http://skepsis.no/blog/?p=3096
    http://skepsis.no/blog/?p=3099

    (De er skrevet i en annen anledning, med henvisninger til en annen kreasjonist, men argumentene er de samme).

    Du finner flagellen i den første linken. Det finnes faktisk modeller for hvordan den kan ha utviklet seg. Ettersom et hvert argument om ikke-reduserbar kompleksitet går ut på å vise, ikke bare at vi ikke vet hvordan noe er mulig, men at det ikke kan eksistere en løsning, fallr argumentet i det noen foreslår en mulig løsning. Løsningen trenger ikke en gang være riktig, det holder at den er plausibel for å rive ned påstanden om at det er umulig at flagellen kan ha utviklet seg.

    @Enda en kommentar:

    Ja, jeg vet at det finnes noen forskere som er kreasjonister. Men de er i et knøttlite mindretall i forhold til den store mengden forskere. De er bare veldig høyrøstede. De påståtte vitenskapelige argumentene – jeg kan nok de fleste – er enten rene usannheter, misforståelser eller gud-i-hullene-argumenter. Du mangler kjennskap til ID-bevegelsens opphav dersom du hevder at den først og fremst er vitenskapelig.

  • Sigve Brekke

    Jeg kan ikke utelukke at kreasjonistene banet veg for en nyoppblomstring av ID på 80 -tallet. Uansett opphav så nytter det ikke å kalle ID for kreasjonisme. Menesket har alltid hatt to mulige forklaringer på materiens opphav, enten ingentin eller en intelligent kilde uavhengig av religioner.

    Uansett skulle denne debatten handle om hvorvidt det er legetimt å diskriminere en lærere dersom man ikke tror på evolusjon, men samtidig har jeg følt behov for å avklare hva jeg tror på siden det stadig dukker opp stråmenn.

    Hvorfor vil jeg alikevell undervise i den vitenskaplig korekte oppfatningen. Jo fordi eleven skal kjenne godt til det paradigme han er oppvokst i. Selv om jeg ikke tror teorien er sann (men høres logisk ut) så er det i henhold til evolusjonteorien man organiserer kunnskapen.

    I fremtiden kan man jo håpe at det blir akseptert å peke på teoriens begrensning, i vertefall blir man diskriminert i det stille for å utale seg på nett.

  • Stig

    «Her er en ateist som forsvarer ID for hva det er:»

    Dr. Bradley Monton som i filosofen Bradley Monton? Ville du latt en filosof utføre hjernekirurgi på deg, eller ville du helst overlatt det til kyndige folk som har ekspertise på fagfeltet? Han har skrevet en bok også, som omtales på hans nettsted som følgende: «Monton does not defend ‘intelligent design’ as true — he thinks it is most likely false.»

    Hvorfor trekker du forøvrig frem en ateist til forsvar for ditt livssyn? Tror du det er religiøst betont å mene ID er stuereint? Her er en religiøs biolog som river ned ID: http://www.youtube.com/watch?v=AK0CYZvaJLw

    Ja, tenk. Det finnes ingen motsetning mot å mene kreasjonisme er tull og samtidig være troende.

    «Hvem denne designeren er? Det sier ikke teorien noe om. Når vi kjøper en kake vet vi at den har et intelligent opphav uten at vi vet noe om personen.»

    Og i tillegg har vi tonnevis med empiri som forteller oss hvor kaken er laget. Vi kan faktisk observere kaken bli lagd, om vi vil. Jeg spurte deg forøvrig hvem du mener designeren er, og om du har møtt mennesker som ikke mener det er den kristne guden?

    «Kreasjonisme bygger på bibelen, ID studerer naturen. Da kommer man til at noen observasjoner i naturen best forklares ut fra et intelligent oppphav.»

    Du er så langt ute på viddene at det er trist å observere. Det er forøvrig interessant å observere at kreasjonister ber vitenskapen dokumentere sine funn og påstander. Med en gang man ber kreasjonister dokumentere sine, inntar de offerrollen og syter høylytt om hvordan det foregår en konspirasjon mot de, satt i system av den etablerte vitenskap.

  • http://twitter.com/Nynorskingen LEIÆ’HSIỺI

    @Karsten Eig

    «God of the gaps» – (kunnskaps)hol-Gud – er eit teologisk omgrep som går attende til dei Henry Drummond og Dietrich Bonhoeffer. Poenget med å snakka om kunnskapshol-Gud er å driva med teologisk sjølvkritikk: Me som er kristne må passa på at me ikkje – i praksis – endar opp med å berre ha trong for Gud som ei forklåring på ting me elles ikkje skjønar. For då er me nøydde til å enda opp i ei stoda der me heile tida må gå frå skanse til skanse.

    «Jeg har altså ikke et “God in the gap Guds” bilde.

    Jo, det har du, fordi ID pr definisjon bruker Gud som en forklaring på fenomener vi pr i dag ikke har et svar på. Om du setter guden inn som forklaring på et vitenskapelig problem er det en gud i hullene, uansett om dette er et påståt hull i informasjon eller et reelt hull i vår kunnskap om Big Bang»

    Du uttalar deg her om teologi. Svaret på spørsmålet om i kva grad Sigve Brekke har eit kunnskapshol-gudsbilete, må difor leitast fram til i teologien. Då kunne me ha tenkt funksjonelt: Dersom Sigve har funne fram til eit syn på Gud der Gud ikkje skrumpar inn etter kvart som vitskapen gjer framgang, so har han ikkje på noko kunnskapshol-bilete av Gud.

    Eg veit ikkje om Sigve er nøgd med mi tilnærming – eg har ikkje studert ID mykje. Men det finst fleire måtar å koma til rette med kunnskapshol-Gud-problematikken. Mange kristne steller seg vel «agnostiske» til spørsmålet om samanhenget mellom Gud og naturen. Medan intelligent design vel er ein måte å prøva å systematisera denne problematikken på ein måte som meir direkte skapar rom for Gud – i vitskapen.

  • Arcus

    «Er det problematisk å tro på intelligent design og samtidig undervise i naturfag?»
    Ja, om du søker å lære bort overtro i naturfagstimene er du ikke lærer, du er predikant.

    «En ateist tror at man kommer fra ingenting, av ingenting og for ingenting»
    Jeg noterer at stråmannsargumenter ikke blir undervist på lærerhøyskolen. Det eneste en ateist «tror» er at det ikke er noen høyere makt(er), derav navnet. Det er ingen automatikk at ateister «tror» på evolusjonsteorien som formulert av Darwin. Du kan sikkert finne noen som tror på Lamarck eller ID. Men jeg antar du mener «ateister» er de dumme vitenskapsfolkene som ikke gir kreasjonister eller Gry Jannicke Jarlum nok tid til å fremsette sine argumenter.

    Hva de fleste av denne typen ateister mener angående begynnelsen av universet er forsåvidt irrelevant i en diskusjon angående evolusjonsteorien, men jeg skal rette på din noget uopplyste holding uansett. Ang. begynnelsen av universet så hevder ingen ateister at det kom av ‘ingenting’. Alt var samlet i et lite punkt som ved begynnelsen av tiden begynte å ekspandere. Hva som kom før vet vi ikke, og vi lager ingen pretenser for å hevde at vi vet hva alt «kommer fra». I Bibelen, på den andre siden, så kommer universet ‘fra intet’: I begynnelsen skapte Gud himmelen og jorden – Av hva vet du ikke.

    Men, det ser ut til at du sikter til begynnelsen av organisk liv på jorden – abiogenese – hvor de fleste ateister holder seg til det som er påvist, og er klare på at mye arbeid gjenstår for å få på plass alle bitene.

    Det du derimot forsøkte å sammenlikne er jo evolusjonsteorien, eller «Darwinismen» i din terminologi, og ID. At du ikke engang har kunnskap nok til å skille tre vidt forskjellige vitenskaplige teorier – Big Bang, abiogenese, utvikling – fra hverandre er kanskje talende i forhold til kunnskapsnivået i forhold til disse.

  • http://twitter.com/Nynorskingen LEIÆ’HSIỺI

    @eirik:

    Evolusjon er ikke mer tabu enn at jorden er rund.

    Det er selvsagt ikke særlig intellligent å hevde at jorden er flat, og at evolusjon er løgn og fanteri fordi det egentlig er en magisk skaper som lagde dyr og mennesker fiks ferdig.

    Det er lett å skjøna at du kjem trekkjande med myten om at jorda er flat. For dette er jo ein myte som er skapt just for å forsvara tankane til Darwin – siterar Jeffrey Burton Russell:

    The reason for promoting both the specific lie about the sphericity of the earth and the general lie that religion and science are in natural and eternal conflict in Western society, is to defend Darwinism. The answer is really only slightly more complicated than that bald statement. The flat-earth lie was ammunition against the creationists. The argument was simple and powerful, if not elegant: «Look how stupid these Christians are. They are always getting in the way of science and progress. These people who deny evolution today are exactly the same sort of people as those idiots who for at least a thousand years denied that the earth was round. How stupid can you get?

    But that is not the truth.

    Denne altomfattende livsløgnen din som har fått deg til å forkaste grunnleggende allmennkunnskap ut vinduet kan nok gjøre folk litt sosialt usikker rundt deg. Det er en naturlig konsekvens av ståstedet ditt

    Det er skilnad på å vera sosialt utrygg og å vera utrygg på om ein ikkje fær arbeid fordi ein står for religiøst tufta synspunkt. Det er det siste problemet Sigve tek opp.

  • http://twitter.com/Nynorskingen LEIÆ’HSIỺI

    @Arcus:

    “Er det problematisk å tro på intelligent design og samtidig undervise i naturfag?”
    Ja, om du søker å lære bort overtro i naturfagstimene er du ikke lærer, du er predikant.

    Det er like problematisk å stå for eit syn tufta på Darwin dersom du er so ivrig på å framføra dette synet at det fører til at du spreider lygn og dikt om kristendom og millomalder – jamfør, nok ein gong, Jeffrey Burton Russel.

  • http://twitter.com/#!/kongharald Harald

    På tide at norsk skole slutter å lære bort at det er mikroorganismer som fører til sykdom. Troen på bakterier og virus er smitteårsak har stått uimotsagt for lenge. Vi som utfordrer etablerte politiske og vitenskaplige sannheter må ligge lavt. Personer som hevder at det er det demoner og himmelkonstelasjoner som er årsak til sykdom blir brutalt knebelet av ”vitenskapelig korrekte” bedrevitere. Nå må norsk skole få «inteligent helsefag» hvor elevene kan lære at kopping og penicillin egentlig er like bra.

  • Harald Grønn

    Kan Sigve Brekke opplyse hvilken skole han underviser på? Slik at vi som benytter oss av skoletjeneste kan ta informerte beslutninger om skolevalg.

  • Øyvind

    «Kreasjonisme bygger på bibelen, ID studerer naturen. Da kommer man til at noen observasjoner i naturen best forklares ut fra et intelligent oppphav.»
    Det vil jeg påstå rett og slett er en argument from ignorance. Og som naturfagslærer burde det være åpenlyst hvorfor, selv med et modikum av innsikt om vitenskap.
    Disse forklaringene (som i litt mer faglige kretser kalles «hypoteser»), hvordan kan disse forsøkes forsterket gjennom falsifisering? Hva er det som motbeviser disse?

    Og; ID er i bunn og grunn rett og slett religion. Man tar en eller annen «allmektig guddom» og sier at den/det lagde universet. Det er den type forklaringer som menneskeheten holdt på med for flere tusen år siden, når man ikke kunne forklare lyn og torden på fornuftig vis. På den tid trodde man på en eller annen form for Grand Architect. Det er akkurat det samme som du gjør nå. Og det er akkurat like lite fundert i fornuft som det var den gangen.

  • http://www.geeljire09.wordpress.com Mohamed

    Sigve Brekke:
    Stråmann? Hvor er stråmannen? Hvor er han? Hvis meg det nå!

    Jeg anbefalte deg en bok og prøvde å forklare forskjellen mellom tro og viten (eiriks formulering er enda mer konsis og bedre). Jeg anbefalte deg den boka fordi jeg personlig fikk mye ut av å lese den. Men hvis du vil lytte til Ray Comfort aka Mr Banana Man eller Ben Stein eller William.A. Dembski eller William Lane Craig for den saks skyld. Well…knock yourself out.

  • http://urblo.no Kenneth Moe

    Helt greit at du ikke tror på evolusjon og er lærer i naturfag. Mindre greit at du åpenbart ikke forstår evolusjon.

  • http://urblo.no Kenneth Moe

    Jeg tar det tilbake: Jeg syns ikke det hadde vært greit selv om du forsto evolusjon. Faktisk tror jeg det er umulig å forstå evolusjon og fortsatt forkynne ID.

  • SuperSindre

    Artig debatt.

    Er ingen ekspert på temaet, men legger merke til at kritikere sjelden er villige til å diskutere IDs premisser eller argumentasjon, men henger seg opp i konklusjonen.

    Så vidt jeg har skjønt er den store forskjellen mellom konvensjonell evolusjonsteori og ID hvorvidt evolusjon skjer ved tilfeldige mutasjoner.

    Evolusjonsteorien er som det hevdes her en særdeles velbegrunnet teori, men den velbegrunnede delen er ID enig i. En skaper som årsak til mutasjoner virker å utelukkes a priori.

    Skal man angripe ID må man angripe følgende premisser:

    - En endring skyldes enten lovmessighet, tilfeldigheter eller en bevisst handling.
    - Mutasjon kan ikke forklares ved lovmessighet. Det er ingen naturlover som styrer mutasjoner.
    - Makroevolusjon skiller seg fra mikroevolusjon ved at ulike mutasjoner må skje samtidig (eks. for at et øye skal være funksjonibelt kreves mutasjoner i øyet, i hjernen og noe som forbinder de to organene).
    - Sannsynligheten for at slike samtidige mutasjoner skal skje i samme organisme er så liten at den må regnes som bortimot umulig i det omfanget det må ha skjedd.

    Som vitenskapelig teori er forøvrig evolusjonsteorien (i hvert fall deler av den) relativt svak, da det er en historisk teori bygget på arkeologiske funn, snarere enn isolerte eksperimenter.

    @utforlaget

  • Arcus

    @LEIƒHSIỺI:
    Darwin er ingen «tro», det er en vitenskap som er gjentatte ganger bevist multidisiplinielt! ID, på den andre siden, har ikke et fnugg av bevis bak seg.

    Det jeg finner pussig er at de som fronter ID kritiserer med at «alternative teorier må også læres bort», men det er kun EN spesifikk teori som skal læres bort. Hva om AKP hadde krevet at lamarckismen også skulle blitt lært bort, støtter ID folkene dette også?

  • N.A

    Brekke:

    I USA har saken flere ganger vært oppe til rettslig behandling, og hver gang har konklusjonen etter grundig bevisførsel vært at ID ikke er en vitenskapelig teori, men kun en religiøs overbevising forsøkt dresset opp i et vitenskapelig språk.

    I rettsavgjørelsen om dette spørsmålet fra 2004 i Harrisburg, Pennsylvania (som er typisk) ble undervisning i ID forbudt i offentlig skole fordi det er et brudd på 1.Amendment. Den republikanske, kristne dommeren John E. Joones konkluderte etter en seks ukers rettsak at det er:

    “overwhelming evidence establishing that intelligent design is a religious view, a mere re-labeling of creationism, and not a scientific theory”

    Siden ID ikke er vitenskap ville det derfor være brudd på grunnlovens forbud mot at offentlige skoler underviser i religiøse trosspørsmål.

    Forøvrig bør det være uproblematisk å kombinere kristen tro med støtte til evolusjonsteorien. Den katolske kirkes naturvitenskapelige kommisjon har således akseptert evolusjonsteorien. Konklusjonen fra kommisjonen er at et overveldende vitenskapelig bevismateriale tilsier at evolusjonsteorien er korrekt og at ID er feil. Fra et katolsk ståsted har Gud skapt seleksjons- og evolusjonssystemet, som over tid har frembrakt mennesket. Teologisk er spørsmålet på hvilket utviklingstrinn Gud ”injistere” sjelen. I en teologisk kommisjon som vurderte de teologiske konsekvensene av denne erkjennelsen ble det i tråd med dette i 2004 konkludert at dette skjedde i et ”ontologisk sprang” og i da helt i overensstemmelse med evolusjonsteorien:

    Acting indirectly through causal chains operating from the beginning of cosmic history, God prepared the way for what Pope John Paul II has called ‘an ontological leap…the moment of transition to the spiritual.’”

    Forøvrig vil jeg anbefale Richard Dawkins bok “The Greatest Show on Earth” fra 2009, som gir en god oppsummering av soliditeten i bevismaterialet for evolusjonen som vitenskapelig etablerte fakta. Det er svært bekymringsfullt at Brekke, basert på kommentarene hans i denne tråden, ikke synes å ha forstått evolusjonsteorien. Det burde ikke være mulig å få tilkjent undervisningskompetanse i naturfag uten at man kan gjengi denne korrekt.

    Til slutt, jeg ville ikke vært komfortabel med en naturfaglærer som til de grader ser bort i fra det rasjonelle fundament som hans eget fag er basert på, og som åpenbart ikke har en tilfredsstillende forståelse av sentrale deler av sitt fag. Dette handler ikke om å undertrykke kritisk tenkning eller diskusjon av alternative teorier, det handler om man kan sitt fag og om man befinner seg innenfor vitenskapen eller har forlatt denne til fordel for religiøse trosforestillinger.

  • Ivar Staurseth

    Jeg deler i utgangspunktet din bekymring for at vi i denne google-alderen etterlater oss så mange spor at en FrP-rektor ikke ansetter lærere med tilhørighet på venstresiden, at en rektor som er ateist ikke ansetter kristne, evt. at en kristen ikke ansetter ateister. Und so weiter. Hva man mener om Gud, formueskatt, privatisering og miljøvern er like irrelevant som hvorvidt man spiller håndball eller golf på fritiden.

    Hakket mer relevant blir det imidlertid når «det man tror på» er direkte knyttet til faget. I Nord-Korea trenger man selvsagt ikke gjøre noe annet bak kateteret enn å lese opp høyt det man skal. Det er litt annerledes i en skole hvor undervisningen er vitenskapelig fundert. Da er det ikke så lett å skille lektoren fra personen. Jeg mener selvsagt at det er revnende likegyldig om en lærer stemmer SV eller Høyre. Men hva om vedkommende tilhører Tjen Folket eller en grumsete høyreekstrem sekt – og skal undervise i religion og historie? Selv om vedkommende lover å formidle noe annet bak kateteret enn i aviskronikker og i kommentarfelt – har vi grunn til å tro det, uten å forutsette at vedkommende er en hykler, hvilket i mine øyne er uforenlig med en kunnskapsbasert undervisning?

    Jeg sammenlikner deg selvsagt ikke med verken stalinisme eller rasisme. Men ettersom ditt syn på biologi strider mot det anerkjente vitenskapelige synet synes jeg ikke det er irrelevant når du ansettes som biologilektor i videregående skole. Det er jo en grunn til at man krever at vedkommende har studert biologi ved en forskningsbasert institusjon!

    Så kan det likevel være tilfelle at ansatte googler og finner ut at søkeren stemmer noe dumt og lar være å ansette vedkommende, eller at hun er kristen, og med en gang trekker den konklusjon at hun vil misjonere i kjemitimene! Evt. at man innenfor fag med ulike tradisjoner, motstridende teorier etc., forsøker ensretting av miljøet – skjønt i slke tilfeller må uenigheten være relevant på intervjuet. Det er en utvikling som jeg også vil advare mot. Men jeg synes ikke dine erfaringer er et eksempel på det, ettersom ditt kontroversielle (i kvantitativ forstand, om ikke annet) syn på intelligent design er relevant for undervisningen, i motsetning til hva du og rektor mener om oljeboring, privatskoler, alkoholavgifter og Gud i seg selv (uavhengig av vitenskapen).

  • http://www.geeljire09.wordpress.com Mohamed

    SuperSindre skrev «Er ingen ekspert på temaet, men legger merke til at kritikere sjelden er villige til å diskutere IDs premisser eller argumentasjon, men henger seg opp i konklusjonen.»

    ————Eh. Konklusjonen kommer vel ikke fra løse lufta men er bygget på en argumentasjonsrekke/bevis av en rekke påstander/premisser? Selvfølgelig skal man henge seg opp i konklusjonen, når premisset i utgangspunkt er ikke vitenskapelig korrekt, men basert på tro. Folk kan tro på hva de vil. Jeg personlig syns det er greit (trenger ikke min velsignelse) at man ansetter folk som er ID-tilhengere/kreasjonister. Men på samme måte som det forventes at du som en pedagog/lærer ikke skal skryte hemningsløst om Venstre under samfunnfagstimene, mens du skittkaster KrF, så kan du ikke stå der og presentere ID som en vitenskapelig «sannhet» og samtidig si at Darwin og evolusjonsteorien er roten til all ondskap (nærmere bestemt: rasisme, nazisme, fascisme etc). Satt på spissen, men fortsatt det finnes folk som går rundt og sier slikt. Dette er Brekke innforstått med. Men å ikle seg en offerrolle og framstille seg selv som en «stakkars» som er forfulgt eller si at dette er tabu er tull og tøys. Over 50 % av verdens befolkning bekjenner seg til den abrahamske troen, ergo de tror på at Gud skapte mennesket (Adam og Eva). En god del av dem – majoriteten aksepterer kreasjonisme (det finnes unntak som en god del katolikker jamfør det N.A nevner,jøder og muslimer som denne imamen her: http://www.thisislondon.co.uk/standard/article-23929834-imam-fears-nutters-could-kill-him-for-preaching-evolution.do.). Nå skal det nevnes at en del religiøse mennesker forkaster makro-evolusjon.

    Så spørsmålet mitt blir igjen: Når ble dette i virkeligheten tabu? Selv om Brekke ønsker å skille mellom ID og kreasjonisme så blir det det samme som å skille mellom Super Nintendo (siden biler og kaker er allerede nevnt og vi elsker slik bildebruk…hehe) og Nintendo Wii. ID er rett og slett kvasivitenskapelig sofisteri hvor de som fremmer det er mer «sofistikerte» og «flinkere» enn den gjengse søndagsskolelæreren og koranskolelærer som lærer deg «pure» kreasjonisme – uten filter!

    ID-tilhengere som de amerikanske jeg nevnte i min forrige kommentar (de kristne og jødiske) og de fra Harun Yahya-nettverket er veldig slu i deres retorikk og framgangsmåte. De fordummer en betydelig del av verdensbefolkning med sitt anti-vitenskapelige propanganda. Dette i seg selv er en grunn til at mange reagerer.

  • hansen

    Diskusjonen er ikke kristendommen vs biologi. Biologien kan ikke forklare alt. Men kristendommen forklarer ingenting. Darwin har bevist kristendommen feil for lenge siden. Men vi vet fortsatt ikke hvor vi kommer fra og hvor vi skal.

  • http://twitter.com/Nynorskingen LEIÆ’HSIỺI

    Arcus:

    Darwin er ingen “tro”, det er en vitenskap som er gjentatte ganger bevist multidisiplinielt! ID, på den andre siden, har ikke et fnugg av bevis bak seg.

    «Darwin» er eit etternamn.

    Det jeg finner pussig er at de som fronter ID kritiserer med at “alternative teorier må også læres bort”, men det er kun EN spesifikk teori som skal læres bort. Hva om AKP hadde krevet at lamarckismen også skulle blitt lært bort, støtter ID folkene dette også?

    Det relevante for debatten er vel spørsmålet om i kva grad ein person som står for lamarckisme hadde kunna vore naturfaglærar.

    Eg forstår Sigve dit at han meiner at svaret er ja, so lenge vedkomande ikkje har problem med å undervisa i den offisielle læreplanen.

    For min eigen del er skeptisk til Darwinistar med ei fundamentalistisk forsvar av det dei meiner at darwinismen impliserar. (For same kor mykje Den katolske kyrkja måtte godta darwinisme, so er nøgda av folk som tek darwinisme til intekt for antireligiøsitet.) Eg ville ikkje ha sendt ungane mine til religionsundervisning med ein Darwinist som hevda at kristne i mellomaldren trudde at jorda var flat – eller som på annat vis meinte det var naudsynt å spreia pseudo-vitskapleg negativitet om vår kulturarv.

  • Sigve Brekke

    Svar til Ivar

    Av din argumentasjon kunne man konkludere med at det er hyklerisk å undervise om islam uten at man selv tror på Koranen. Det kan være mange ting jeg er uenig i i skolen, men jeg kommer alltid til å være lojal mot lærepan og arbeidsfelleskep.

    For interesserte kan man få en sammenfattet diskusjon på linken under om ID og den vanligste kritikken mot dette synet:

    http://www.apologetics315.com/2012/01/interview-on-intelligent-design-casey.html?utm_source=dlvr.it&utm_medium=facebook

  • Per Erik

    Klarer du, Sigve, å la være å fronte ID i en undervisningssituasjon? Hvis du klarer å skille jobb og personlig overbevisning ser jeg ikke noe problem her i det hele tatt. Lykke til i den nye jobben :)

  • Øyvind

    «Av din argumentasjon kunne man konkludere med at det er hyklerisk å undervise om islam uten at man selv tror på Koranen.»
    Man kan fint undervise om religioner. Det burde foregå i historie og/eller samfunnsfag. Det er derimot hyklerisk å forkynne islam uten å selv tro på koranen. Det er en viss forskjell der?

  • http://twitter.com/Nynorskingen LEIÆ’HSIỺI

    @Mohamed:

    Men å ikle seg en offerrolle og framstille seg selv som en “stakkars” som er forfulgt eller si at dette er tabu er tull og tøys.

    Det spelar då inga rolle om dei fleste i verda etter ditt syn er kreasjonistar dersom Sigve ikkje fær den jobben han søkjer på fordi han har ytra seg om ID?

    Men dette med ID er no berre eitt døme på eit problem, etter mitt syn. Det er t.d. mogeleg å få jobb som Fylkesmann i Oslo og Akershus jamvel om ein meiner at homofili er snakk om eit personleg val. (Ja, mange kjønsforskar meiner visst det same – det viste jo Hjernevask.) Men at mange andre – i praksis – mistar/kkje fær tilbod om jobb fordi dei deler Svarstad Haugland sine synspunkt, er eg samstundes òg redd for.

  • http://twitter.com/Nynorskingen LEIÆ’HSIỺI

    @Øyvind:

    Darwinistar som har den haldning at dei skal forkynna utviklingslæra, bør me taka nei til.

  • Sigve Brekke

    Svar til øyvind:

    Så du mener man forkynner i naturfag, jeg trodde man underviste.

  • http://folk.uio.no/ivarsta Ivar Staurseth

    Svar til Sigve Brekke:

    Nei, av min konklusjon kan man IKKE slutte at en nøytral, korrekt undervisning i Islam forutsetter blind tro på Koranen. Det er en logisk kortslutning fra din side, som du bl.a. nevner i innlegget ditt!

    Slutningen hadde vært riktig dersom religionsfagets fremstilling av Islam var dogmatisk, basert på en ordrett lesning av Koranen. Da ville det vært hyklersk å fremføre den undervisningen, uten å tro på Koranen. I virkeligheten (slik dine kolleger, religionslærerne, kan bekrefte) er religionsfaget tuftet på vitenskaper som religionshistorie og religionsvitenskap. Det forhindrer ikke at man kan være kristen, jøde, eller muslim, og fremdeles gi seriøs religionsundervisning, så lenge man har sin lojalitet knyttet til de vitenskapelige fakta, og ikke setter religiøse dogmer foran dem.

    Ditto for biologi, men du har valgt å trekke din kristentro inn i din forståelse av biologien.

  • Anders

    «Helt greit det, jeg sier ikke at kunnskap nødvendigvis må stå i motseting til gudstro. Men det foreligger ikke kunnskap som du kan bruke som et gudsbevis.» Veldig bra.

    Denne debatten må være det mest bortkasta tidsressurs jeg har sett. Siden alle som skriver her, ikke snakker i samme debatt, men skulle tro dere debatterte hver deres kamp, som i seg selv er meningsløs.

    Sigve; Jeg ser du er født i 85. Når du er blitt eldre, vil du tenke tilbake til denne, og tenke, hvorfor tenkte jeg sånn? Hvorfor var jeg sånn..? Så nærtagende? Du skal berømmes for at du fronter alternativ tenkning. Det fortjener vitenskapen å få i fleisen. Vitenskap er jo heller ikke konstant siden den stadig dukker opp med » Det var ikke sånn. Nå har vi funnet…» og så ser historien plutselig helt annerledes ut. Men ikke vær så hårsår. jeg og var slik. i 85.

    Dere andre; En skulle tro det var andre ting å bekymre seg om, enn en lærer som tenker annerledes i SV-skoleverket anno 2012. Ta dere sammen. Født i 86? Her må flere ta seg sammen og plante føttene godt på jorda. Det finnes ikke fnugg av intellektualitet i debatten deres, heller ikke hos minerva som har publisert denne artikkelen i utgangspunktet. Så her mistet minerva poeng. SØPPEL.

  • SuperSindre

    Mohammed skrev: «––––Eh. Konklusjonen kommer vel ikke fra løse lufta men er bygget på en argumentasjonsrekke/bevis av en rekke påstander/premisser? Selvfølgelig skal man henge seg opp i konklusjonen, når premisset i utgangspunkt er ikke vitenskapelig korrekt, men basert på tro.»

    Hvilket av de premissene jeg listet opp mener du er basert på tro? Jeg kan ikke nok om ID til å si at premissene er sanne, men har til nå ikke funnet noen som argumenterer vitenskapelig og overbevisende mot dem.

    Det ser ut som det er litt forvirring omkring premiss og konklusjon her. ID-tilhengere vil vel hevde at skaperen er konklusjonen og ikke et premiss. Man kan selvfølgelig innvende at konklusjonen kan være farget av forskernes religiøse bakgrunn, men det samme kan innvendes mot ateister i forhold til evolusjonsteorien.

    Som lærer selv har jeg ingen problemer med å lære bort om religioner jeg ikke slutter meg til, historiske forklaringer jeg synes er forenklende eller vitenskapelige teorier jeg mener er svake. Jeg har heller ingen problemer med å påpeke at dette er teorier/meninger og at det er andre som mener noe annet. Det viktigste ungdom i dag kan lære er kritisk tenkning.

    @utforlaget

  • Halvard

    Sigve
    Intelligent Design = Kreasjonisme

    Discovery Institute, Intellignet Design bevegelsens alibi er en kristen konservativ think tank som lever paa penger fra konservative kristene organisasjoner.

    Det finnes ingen forsking innen Intelligent Design bevegelsen.

    Intelligent Design bevegelsen hadde sin mulighet til aa vise at den var en vitenskap her i USA under Dover saken. Bevegelsen viste seg aa vaere kreasjonisme med nye klaer.

    Alle boer se alle 12 episodene av denne dokumentaren
    http://www.youtube.com/watch?v=33k5As89pR4

    Intelligent Design er IKKE forskning.

  • Ragnar Ove

    Som så ofte diskuterer dere på siden av saken: Darwin eller Gud eller hva som helst kan dere uansett ikke løse, poenget er hvor tolerant en skole skal være når den ansetter folk. At elever blir utsatt for FLERE synspunkt, ikke bare ETT fra statens side.

  • Biolog

    Dette var bare pinlig, Sigve. Det er hevet over enhver tvil at makroevolusjon har funnet sted. Dette er antivitenskapelig og skammelig. Gå og les en (skikkelig) bok.

  • Sigve Brekke

    Mange har prøvd å omdefinere hva ID egentlig er, det fører til at diskusjonen sklir ut. Det er førøvrig genske uredelig å svartmale ID. De som kjenner forskningsprogramme vet godt selv at det ikke argumenterer ut bra Bibelen, men ut fra oppdaginger i naturen.

    Disse linkene burde være klargørende:

    http://www.discovery.org/csc/topQuestions.php

    http://www.apologetics315.com/2012/01/interview-on-intelligent-design-casey.html?utm_source=dlvr.it&utm_medium=facebook

  • Biolog

    Og når det er sagt, fornektelse av noe så vitenskapelig veletablert som evolusjon er et så alvorlig tegn på en brist i kognisjonen at det grenser til psykisk lidelse. Jeg forstår fullt og helt skolens skepsis, og jeg ville ikke latt deg være i nærheten av mine barn i en undervisningskontekst.

  • Øyvind

    Sigve: Er det vi eller du som prøver å redefinere ID? Ta definisjonen på engelsk wikipedia:

    Intelligent design (ID) is the proposition that «certain features of the universe and of living things are best explained by an intelligent cause, not an undirected process such as natural selection.» It is a form of creationism and a contemporary adaptation of the traditional teleological argument for the existence of God, presented by its advocates as «an evidence-based scientific theory about life’s origins» rather than «a religious-based idea». The leading proponents of intelligent design are associated with the Discovery Institute, a politically conservative think tank, and believe the designer to be the Christian God.

    ID seeks to redefine science in a fundamental way that would invoke supernatural explanations, a viewpoint known as theistic science. It puts forward a number of arguments, the most prominent of which are irreducible complexity and specified complexity, in support of the existence of a designer. The scientific community rejects the extension of science to include supernatural explanations in favor of continued acceptance of methodological naturalism, and has rejected both irreducible complexity and specified complexity for a wide range of conceptual and factual flaws.

    Det hjelper ikke å si at ID er basert på noe annet enn gammel overtro, når det er nettopp det som er tilfellet. ID er kreasjonisme iført pseudovitenskapelige klær.

  • Rune Holmen

    Sigve Brekke:
    De nettstedene du gjentar irriterende mange nok ganger er MEGET klargjørende. At du bruker disse nettstedene og videosnutter som «bevis» er såpass klargjørende at jeg som har en 10. klassing hjemme nå, gjerne skulle vite hvilken skole du jobber på.

    ID er ikke forskning. Det er kun et kreasjonistisk teaterkostyme. Jeg ønsker ikke at mine barn skal undervises av noen som mener at ID er forskning.

  • Sigve Brekke

    Svar til Øyvind.

    Henvisningen til Wikipedia viser at man ikke alltid kan stole på den nettsiden. Skal du finne ut hva Islam er går du i Moskeen, ikke i Kirken. Skal du finne ut hva en ateist står for ville han vel misslikt at kristne fikk definere hans meninger. Man går rett og slett til kilden hvor ideene kommer fra. Derfor er mine linker legitime. Andre kan selvfølgelig dikte opp hva jeg mener eller hva ulike begreper betyr. Det er ingen sikker kilde for å finne ut sannheten om hva jeg egentlig står for. Når jeg skal finne ut hve dawinister tror på så leser jeg deres litteatur

  • Stig

    «Hvorfor tror du det finnes mange mennesker og en god del forskere som også tror på ID?»

    @Enda en kommentar: Møt Project Steve: http://ncse.com/taking-action/project-steve

  • Stig

    «Darwin er eit etternamn.»

    [...]

    »For min eigen del er skeptisk til Darwinistar med ei fundamentalistisk forsvar av det dei meiner at darwinismen impliserar.»

    @LEIÆ’HSIỺI: Darwin er et etternavn skriver du i ene setningen, og i neste benytter du deg av ‘Darwinist’? Kan du forklare hva en Darwinist er?

    I tillegg, du kjenner sannsynligvis all den overveldende empirien som ligger bak evolusjonsteorien.

    Kan du liste opp noen vitenskapelige funn som støtter kreasjonisme?

  • Ulrik F. Thyve

    For det første, å tro på «mikroevolusjon» uten å tro på «makroevolusjon» er meningsløst, som dette bildet skisserer ganske fiffig:

    http://i.imgur.com/xWpvw.jpg

    For det andre, å påstå at det er _empirisk_ og _vitenskapelig_ grunnlag for å påstå at det MÅ være en intelligent designer viser at man a) ikke kjenner til reell empiri og b) at man ikke forstår vitenskapelig metode. Det er ingen empiri som indikerer, forutsetter eller på annet vis gjør et argument om en intelligent skaper sannsynlig. Tvert om har man en rekke empiriske data som indikerer at hvis det nå, mot enhver formodning, skulle finnes en skaper, så er han ikke særskilt intelligent. Giraffer anyone…?

    For det andre, dette meningsløse argumentet om kaker, biler og båter…? Har ikke dette blitt tilbakevist i det uendelig i flere tiår? Man kan ikke sammenligne en bil med en skapning som _formerer_ seg. Det er jo nettopp formeringsevnen, ulike eksterne faktorer og isolasjon som skaper ulikheter. Om man bruker analogier som på ingen måte replikerer disse forholdene, og trekker vidtrekkende konklusjoner fra disse analogiene, så kan man ikke forvente å bli tatt seriøst.

    For det tredje, og siste: man lar ikke mennesker som tror på demoner og åndeutdrivelse undervise i medisin, man lar ikke mennesker som ikke tror på gravitasjonskraften undervise i fysikk, man lar ikke mennesker som tror jorden er 6000 år gammel undervise i geologi.. Og mennesker som mangler enhver form for kjennskap til vitenskapelig metode, kritisk tenkning, kildekritikk og andre viktige egenskaper for et moderne menneske, bør ikke undervise i _noe_ fag, punktum.

  • Øyvind

    Sigve: Det var nada argumenter i det du kommer med. Det du sier er at «jeg liker ikke kilden, så den erklærer jeg ugyldig». Det funker ikke sånn, og det burde en lærer vite. I så fall kan jeg erklære samtlige av dine kilder for søppel, uten videre argumenter. Det fungerer bra i en diskusjon.

    Og nei, jeg går ikke i moskeen for å lære om islam. Faktisk er det en elendig måte å lære en religion på. Ønsker jeg å lære noe om religioner, tar jeg kontakt med en religionshistoriker/religionsforsker. Noen som faktisk kan noe om religionen basert på vitenskap. Vil jeg vite noe om et emne, ser jeg til forskning eller gjør egne forsøk. Jeg finner ikke opp en «grand architect» og bygger argumenter rundt denne for å forklare noe jeg ikke forstår. Jeg framlegger en hypotese og prøver å falsifisere den. Det er slik man får bedre kunnskap om verden rundt seg. Ikke ved å lage eventyr og forsvare de innbitt mot ethvert godt begrunnet argument.

    Det har blitt påpekt mange ganger i diskusjonen, med gode argumenter, at ID bygger på kreasjonisme. At du ikke liker den avsløringen gjør den ikke mindre sann. At du fortvilt forsøker å definere kreasjonisme og kristendom bort fra ID-begrepet, endrer ikke hva ID bygger på. At du er religiøs bryr jeg meg fint lite om, men at du er direkte vitenskapsfientlig ser jeg definitivt som et problem i en naturfagsstilling.

  • Ulrik F. Thyve

    Jeg merker meg at saklige, men sterkt kritiske innlegg blir slettet.

    Da mistet jeg siste rest av respekt for minerva.

  • eirik

    @Sigve:

    Du hevder ID er vitenskap, og ikke religiøs kreasjonisme.

    Det kan du oppklare ved å forklare følgende: Hvor du har studert ID? Hvor har du dette fra? Er det et universitet eller høyskole i Norge eller i utlandet?

  • http://karsteneig.no Karsten Eig

    @Sigve Brekke:

    Du kan gjenta til krampa tar deg at ID ikke er kreasjonisme, men det blir ikke mer riktig for det. Ikke minst fordi argumentene som brukes til støtte for ID oftest er de samme (påstått manglende overgangsfossiler, den kambriske eksplosjonen, at noe er for komplekst til å ha utviklet seg selv). Det er riktignok et par forskjeller mellom klassisk kreasjonisme og ID; ID fokuserer mer på påstått ikkereduserbare strukturer på biokjemisk/mikrobiologisk nivå, og mindre på å bevise at jorden er ung. Men i hovedsak kvakker og går anda som før.

    I det såkalte «Wedge document» er Discovery institute helt åpne om at ID først og fremst er religiøst motivert:

    http://www.discovery.org/scripts/viewDB/filesDB-download.php?id=349
    http://www.antievolution.org/features/wedge.html

    Som tidligere nevnt; jeg er helt enig i at man ikke kan nekte lærere å undervise i naturfag selv om de er personlig uenig i pensum. Vi skal ikke ha tankepoliti i skolen. Så lenge læreren kan skille pensum og egen personlig overbevisning ser jeg ingen grunn til å nekte vedkommende jobben. Hvor lenge du vil holde ut med å snakke mot din egen religiøse overbevisning i naturfagstimene er en annen sak.

    Men: Det kan finnes grensetilfeller: Jeg er absolutt faren for at en kreasjonistisk lærer kan komme til å trekke frem ID, på samme måte som en svært religiøs lærer kan komme til å bruke religionstimene til misjonering, en holocoustrevisjonist kan misbruke historietimen eller en rasist kan misbruke biologi- eller samfunnsfagtimen. Som en parallell; min navnebror, professor i geofysikk Karsten Storetvedt ble fjernet fra undervisningen ved Universitetet i Bergen da han begynte å undervise sin egen hjemmesnekrede teori istedet for platetektonikk. Geologi uten platetektonikk er som biologi uten evolusjonsteori, man blir uten forklaringen som får det til å henge sammen.

    Men slik fjerning må kun skje dersom læreren up front sier at han vil undervise ID, eller viser seg å gjøre det etter hvert.

    I fremtiden kan man jo håpe at det blir akseptert å peke på teoriens begrensning, i vertefall blir man diskriminert i det stille for å utale seg på nett.

    I vitenskap er det absolutt akseptert å peke på teoriers begrensinger, og de få gangene kreasjonister påpeker slike begrensinger er de oftest godt kjent på forhånd. Men det er ikke diskriminering å bli møtt med påpekning av hvorfor ID er feil.

  • http://karsteneig.no Karsten Eig

    @LEIfHSII

    Jeg ser poenget ditt og jeg var nok litt upresis. Jeg skal ikke påstå at Sigve Brekke har et god-in-the-gaps-gudsbilde generelt. Men ID-argumentene koker alltid ned til enten rene usannheter eller god-in-the-gaps-argumenter, og når Brekke bruker dette som argumenter for Guds eksistens kan han ikke vri seg unna at den delen av argumentasjonen han ser nettopp god-in-the-gaps.

  • http://karsteneig.no Karsten Eig

    @SuperSindre

    - En endring skyldes enten lovmessighet, tilfeldigheter eller en bevisst handling.

    Mutasjoner er naturligvis begrenset av naturlover, men er ellers tilfeldige.

    - Mutasjon kan ikke forklares ved lovmessighet. Det er ingen naturlover som styrer mutasjoner.

    Jo, det kalles fysiske og kjemiske lover. Ikke glem at DNA bare er et stort kjemisk molekyl.

    - Makroevolusjon skiller seg fra mikroevolusjon ved at ulike mutasjoner må skje samtidig (eks. for at et øye skal være funksjonibelt kreves mutasjoner i øyet, i hjernen og noe som forbinder de to organene).

    Epic fail! Makroevolusjon er bare mikroevolusjon som pågår lenger. Skillet mellom de to er en kreasjonistisk stråmann. Øyet kan utvikle seg gjennom mange trinn, som hver gir organismen en økt sammsynlighet for overlevelse, og dermed selekterer mutasjonen for å bringes videre. Beskrevet et stykke ned i linken her: http://skepsis.no/blog/?p=3096

    - Sannsynligheten for at slike samtidige mutasjoner skal skje i samme organisme er så liten at den må regnes som bortimot umulig i det omfanget det må ha skjedd.

    Det er ikke nødvendig med mange samtidige mutasjoner, derfor er dette en ren stråmann. At du påstår dette tyder på at du ikke vet så mye om evolusjon.

    Som vitenskapelig teori er forøvrig evolusjonsteorien (i hvert fall deler av den) relativt svak, da det er en historisk teori bygget på arkeologiske funn, snarere enn isolerte eksperimenter.

    Tvert om. Evolusjonteorien er i utgangspunktet bygget på observasjoner av levende organismer (biologi) i kombinasjon med fossiler (paleontologi). Senere er den bekreftet ved genetikk i nettopp laboratorier.

  • Sigve Brekke

    Svar til Karsten

    Det er ikke motivasjonen din som avgjør om man driver vitenskap. Newton, Galileo, Kepler…..Ja svært mange av vitenskapsmennene knyttet til den vitenskapligge revolusjonen var motivert ut fra troen på en skaper. De trodde naturen var skapt og dermed forståelig. Dermed begynte de å studere naturen motivert ut fra at den var skapt, men man finner også eksempler på ateister som studerer naturen ut fra en ateistisk motivasjon. Det er uansett irellevant hva som mitiverer deg.

    I skole sammenheng er jeg kritisk til at men fletter inn sin personligge motivasjon i undervisningen. Derfor vil jeg personlig ikke komme til å gjøre dette, men jeg ser at man gjerne slipper inn svartmaling av religion i undervisningsmateriell for naturfag. Det er jeg kritisk til, og man kan lure på hvorfor man slipper inn en mann som Dawkins i skolen når han sier at eleven tro sløver hans intellekt.

    På sikt mener jeg at man burde gjøre en av to ting. Rydde opp i sitt eget hus eller fremstille de teistiske motargumentene likeverdig med de ateistiske argumentene.

    Man må da kunne kritisere fremstillinger i læringsressurser og ha meninger som strider mot verdensbilde presangtert i skolebøkene uten å bli konfrontert med dette i forbindelse med jobb så lenge man opptrer korkt i klasserommet. Det er egentlig utgangspunktet for denne debatten.

  • http://karsteneig.no Karsten Eig

    @Ragnar Ove:

    Darwin eller Gud eller hva som helst kan dere uansett ikke løse, poenget er hvor tolerant en skole skal være når den ansetter folk. At elever blir utsatt for FLERE synspunkt, ikke bare ETT fra statens side.

    Vi kan ikke avgjøre guds eksistens, men evolusjonteorien er understøttet av et enormt vitenskapelig materiale. Du gir inntrykk av at ID og evolusjon skulle være likeverdige synspunkter, som elevene selv bør få velge mellom. Det er de ikke. Evolusjon har enorm empirisk støtte – ID baserer seg på løgn og god-in-the-gaps-argumenter, dvs ingen vitenskapelig støtte. Derfor hører evolusjon hjemme i skolen, ikke ID.Hve læreren tror på er selvsagt i utgangspunktet vedkommendes privatsak, men pensum er det ikke.

  • eirik

    Hvor har du studert ID, Sigve?

  • Øyvind

    «Rydde opp i sitt eget hus eller fremstille de teistiske motargumentene likeverdig med de ateistiske argumentene.»
    For å sette det bittelitt på spissen: Hvorfor skal eventyr likestilles med fakta? Det er ingenting likeverdig der.

    «Science adjusts its views based on whats observed. faith is the denial of observation so that belief can be preserved» — Tim Minchin
    I ID/kreasjonisme-debatten er det et svært relevant sitat.

  • Rune Holmen

    Iflg Brekkes argumentasjon vil det å slippe til Dawkins/Hitchens i religionsundervisning være helt på sin plass. Man får jo da en alternativ vinkling.

    Dog bemerkes: Problemet med Dawkins/Hitchens tilnærming er at den er objektivt etterprøvbar.

  • Sigve Brekke

    Svar til Karsten Eig

    I følge Aristoteles var jorden i universets sentrum (Geosentriske verdensbildet. Man hadde hauger med bevis for at dette var sant. For eksempel falt alle steiner mot sentrum hver gang man testen hypotesen. Slik kunne man holde på i det uendeligge og dokumentere at jorden var i sentrum.
    Så en dag kom Kopernikus og kullvente hele verdensbildet, men han møtte motstand av detidens makthavere (Kirken, ps hen var selv troende) Jeg mener at den voksende mengden kunnskap man får om cellen gjør det vanskelig å tro at evolusjonsteorien er sann og at kontroverser til denne problematikken burde bli belyst i skolen i stede for at elevene ramler over argumentene på internett.

  • eirik

    Før du begir deg inn på å utnevne deg selv til den nye Galileo..

    Men hvor har du studert ID, og hvor har du studert evolusjon ved naturlig utvalg?

  • http://karsteneig.no Karsten Eig

    @Sigve Brekke:

    Jeg er enig i at motivasjonen ikke bør være avgjørende, så lenge man holder seg til normal vitenskapelig metode. Og jeg er heller ikke særlig begeistret for Dawkins; han er for firkantet og har en temmelig tvilsom historieskriving. Dawkins vil være et funn i biologitimen – i religionstimen har han mindre å bidra med.

    Problemet med ID-bevegelsen i USA er at den, som wedge-dokumentet viser, egentlig bare er kreasjonisme i ny utgave – same shit, new wrapping. De fleste argumentene er til og med like. Og kjenner man kreasjonismens historie i USA ser man fort at de må gjøre dette for å kunne komme seg inn i skolevesenet pga det klare amerikanske skillet mellom stat og religion.

    Jeg skal ikke nekte for at fx Behe og Dembski også mener at de har en vitenskapelig bevis for Gud/designeren, men det er mer å regne som en bonus.

  • http://karsteneig.no Karsten Eig

    @Sigve om Aristoteles:

    Vitenskapshistorisk er dette interessant. Men med mindre du skal henfalle til en relativisme der en hver kan være salig i sin tolkning av observasjoner, beviser den ikke noe om hvorvidt ID er gyldig eller ikke.

    ID lider av et fundamentalt logisk problem: Den søker å bevise at noe (en biologisk prosess, struktur…) ikke kan være dannet uten inngrep av en designer. IDerne er fullstendig klar over at det ikke holder å vise til at vi ikke kjenner en løsning nå, men at løsningen ikke kan eksistere. Problemet er at for å bevise det måtte man kjenne til alle mulige måter fx flagellen kunne bli dannet på, dvs et uendelig antall mulige løsninger, og så vise at de alle ikke var gyldige. Det er, vel, umulig. Derfor blir ID bygget på god-in-the-gaps-argumenter.

    Som vist i linkene jeg postet, det finnes gode forklaringsmodeller for fx bakterieflagellen. Jeg vet ikke om de er riktige, men det er heller ikke poenget. Så lenge modellene er biologisk mulige vil en hvilken som helst modell motbevise påstanden om at en utvikling av flagellen er umulig, at løsninger ikke kan eksistere.

    Verden er full av uløste vitenskapelige problemer. Ekte forskere forsker da videre. ID slår seg de facto til ro med å ikke vite. Det er ikke vitenskap, det er latskap.

  • eirik

    @ Sigve: Jeg vil gjerne vite hvor du har studert det du hevder er en vitenskaplig teori om intelligent design. Er det på universitetet i Oslo eller Bergen, eller er det på en høyskole, eller der det et universitet i utlandet du har studert dette?

    Og hvor har du studert evolusjonsbiologi? Jeg mener, før du avviser teorien om evolusjon, av de aller fleste ansett som den mest banebrytende og kraftfulle teorien i vitenskapens historie, har du selvsagt satt grundig i dennes vitenskaplige grunnlag.

    For det er vel ikke bare noe du har lest på kristne nettsider av kristne tenketanker, er det vel? Det vil jo være en tanke… ukritisk.

  • Sigve Brekke

    Til Karsten

    Må vell innrømme at jeg er blitt litt lei av å stadig fortelle at jeg ikke tror på at Gud finnes i hullene vi ikke kan forstå, man at han manifisterer seg i skaperverket som vi kan forstå. Jeg underbygger argumentasjonen min med følgende link. ja til vitenskap, ja til mer kunnskap.

    http://www.youtube.com/watch?v=np52hebADpw

  • eirik

    Sukk.

    *rister lett sjokkskadet på hodet av utdannede lærere som viser til youtube som vitenskap*

  • Bjarte Skogøy

    Det mest fascinerende i denne debatten og ID/evolusjon er at så mange gir uttrykk for at vitenskap er læren om sant og usant.

    Newtons teorier fungere innenfor de rammene de håndterer. Relativitet fungerer innenfor sine rammer.

    Vitenskapen aksepterer at den ikke vet mer enn den observerer og at den ikke er læren om sant og usant. Folk flest derimot ser ut til å oppfatte vitenskapens «nåtilstand» som den endelige sannhet.

    Sitat fra wikipedia(http://en.wikipedia.org/wiki/Isaac_Newton#Mechanics_and_gravitation) angående Newton og gravitasjon:
    «Newton’s postulate of an invisible force able to act over vast distances led to him being criticised for introducing «occult agencies» into science.[50] Later, in the second edition of the Principia (1713), Newton firmly rejected such criticisms in a concluding General Scholium, writing that it was enough that the phenomena implied a gravitational attraction, as they did; but they did not so far indicate its cause, and it was both unnecessary and improper to frame hypotheses of things that were not implied by the phenomena. (Here Newton used what became his famous expression Hypotheses non fingo).»

    På samme måte mener jeg man kan og bør argumentere for at evolusjonensteori ikke har belegg eller nytteverdi i forhold til spørsmålet om skapelse og opphav.

    Sånn utenom det så er det på grensen til komisk når noen blir så til de grader provosert av at det stilles spørsmål ved evolussjonsteori. Det ligner jo mer på religiøs fundamentalisme …

  • http://karsteneig.no Karsten Eig

    @Sigve Brekke:

    Så den videoen. Greit nok å se på den fantastiske naturen, alt vi forstår og si «aaahh, awesome! Gud gjorde dette» hvis man først er kristen. Men det er ikke et logisk argument for guds eksistens.

    Lennox henviser til at det vi forstår øker gapene, eksemplifisert ved at biologisk informasjon er digital (DNA). Om man vil kan man godt si at den er digital, men DNA er fortsatt bare et kjemisk molekyl. Det er fortsatt et god in the gaps-argument å bruke gud som en forklaring på det vi ikke enda har en forklaring på. At forskningen stadig vekk vil finne nye ting den ikke vet forklaringen på endrer ikke den fundamentale logiske feilen.

  • http://karsteneig.no Karsten Eig

    @Bjarte Skogøy:

    På samme måte mener jeg man kan og bør argumentere for at evolusjonensteori ikke har belegg eller nytteverdi i forhold til spørsmålet om skapelse og opphav.

    Kjør på. All kritikk av etablert vitenskap er velkommen. Så lenge den er underbygget av fakta. Men argumentene som fremføres av kreasjonister og IDere er dessverre enten gud i hullene-argumenter, misforståelser eller rett og slett usanne.

    Sånn utenom det så er det på grensen til komisk når noen blir så til de grader provosert av at det stilles spørsmål ved evolussjonsteori. Det ligner jo mer på religiøs fundamentalisme …

    Ta mannen i stedet for ballen? Problemet er ikke at kreasjonister stiller spørsmål, det er at de gjør det ved å stadig komme trekkende med for lengst tilbakeviste argumenter.

    Evolusjonsteorien er ikke bare en teori, den er selve rammeverket som gjør at vi kan forstå hvorfor livet er som det er. Det blir som om noen skulle stille spørsmål om gravitasjon eksisterte og deretter bli sur på fysikerne som påpeker at argumentene mot ikke holdt – og at det blir vanskelig å gjøre fysikk uten.

  • Bjarte Skogøy

    @Karsten Eig
    Du misser poenget mitt. Newton argumenterer for at gravitasjon som fenomen er nok for teorien. Årsaken er ikke relevant for om fenomenet eksisterer eller ikke.

    Akkurat slik er det med evolusjonsteori også. Fenomenet er nok. Årsaken eller ev. nødvendigheter eller unødvendigheter for en skaper eller en begynnelse eller hva som helst er ikke relevant.

    Så jeg fatter og begriper ikke hva ID-tilhengere er så besatt av, eller hvorfor mange evolusjons-tilhengere tror de har motbevist en skaper.

    Har vi en skaper så har vi en skaper. Totalt uavhengig av hvilke teorier vi har om skaperen eller livet eller utviklingen.

    At vi har en metode for å forstå hvorfor livet er som det er forteller hverken mer eller mindre enn at vi har en metode.

  • http://karsteneig.no Karsten Eig

    @Bjarte Skogøy:

    Du har rett i at evolusjonsteorien ikke motbeviser en gud/skaper. Den beviser bare at det ikke er nødvendig med en. ID-tilhengerne ønsker derimot å bruke ID til å bevise at en slik skaper finnes

  • eirik

    @ Bjarte: Evolusjonsteorien motbeviser faktisk (blant annet) en spesifikk annen «teori», nemlig den i bibelens skapelsesberetning(er) om en gud som skapte dyr og mennesker fiks ferdig.

    I tillegg motbeviser den lamarckisme, og sikkert en hel haug andre historiske gjetninger om hvor mennesker og dyr kommer fra.

    Den motbeviser selvsagt ikke den moderne norske NOMA-guden som f.eks. sto bak bigbang e.l.

  • Bjarte Skogøy

    @eirik
    Evolusjonsteorien impliserer at andre teorier om de samme fenomenene ikke stemmer ja, men er egentlig ikke så veldig relevant i forhold til Bibelens skapelsesberetning da den faktisk inneholder to fortellinger som ikke er like. (1. Mos 1,1 – 2,3 og 2. Mos 2,4-25)

    Bibelens skapelsesberetning har som formål å forklare hvorfor mennesket og jorden og alt annet er til, ikke hvordan. Evolusjonsteorien forklarer hvordan, men ikke hvorfor. Bibelens skapelsberetning har like liten vitenskaplig relevans for hvordan vår fysiske verden henger sammen som å fortelle barna at presangene kommer fra julenissen. Og det er det jammen nok av ateister og humanetikere som liker å gjøre, av en eller annen merkelig grunn.

    @Karsten Eig
    «ID-tilhengerne ønsker derimot å bruke ID til å bevise at en slik skaper finnes»
    Dette er et mysterium for meg. Uansett hvor intelligent designet ser ut impliserer det ingen skaper, spør du meg. Kan evolusjon oppstå ut av Big Bang, så kan sikkert et fiks ferdig univers ha oppstått ut av Big Bang. Og for meg ville begge deler være like utrolige og fasinerende.

  • ali

    Ettersom bruk av matematikk/statistikk/IT for kritikk av evolusjonsteorien interesserer meg, så tillater jeg meg å delta i debatten.

    Først litt om relevans for bruk av matematikk/statistikk i debatten. Den menneskelige DNA-sekvensen (genomet) ble fullstendig kartlagt i år 2003. Et genom er hele DNA-sekvensen i en organisme, inkludert genene. Genene bærer informasjon om hvordan lage alle de proteinene som kreves av organismen. Disse proteinene bestemmer blant annet hvordan organismen ser ut, hvor godt den forbrenner føden eller bekjemper infeksjon, og noen ganger også hvordan den oppfører seg. DNA består av fire lignende kjemikalier (kalt baser eller nukleotider og forkortes A, T, C og G) som er gjentatt millioner eller milliarder av ganger i løpet av et genom. Den menneskelige genom, for eksempel, har 3200 millioner par nukleotider.

    Rekkefølgen av A-er, T-er, C-er, og G-er i det menneskelige genomet er ekstremt viktig. Rekkefølgen ligger til grunn for alle livets mangfold, og bestemmer hvorvidt en organisme er menneske eller annen art som gjær, ris, eller bananflue, som alle har sine egne genomer, og som også blir kartlagt i genomprosjekter. Mutasjoner blir definert som endringer i DNA-sekvensen, og etter evolusjonsteorien er disse endringene tilfeldige. Spørsmålet er da hvor mange forskjellige DNA-sekvenser man kan få med en DNA-streng som består av 3,2 milliarder tegn.

    Eksempelvis kan man se på hvor mange forskjellige strenger (permutasjoner av strenger) man kan få av en streng bestående av 150 nukleotider. Svaret er 4^150, eller ca 10^90, dvs et 1-tall med 90 nuller etter. Til sammenligning er det antatt at antall atomer i det observerbare universet er omtrent 10^80.

    Det menneskelige genomet består som sagt av 3 200 000 000 nukleotider, og antall permutasjoner på en streng bestående av 3 200 000 000 nukleotider er 4^3 200 000 000, eller omtrent 10^1 000 000 000, altså et 1-tall med 1 000 000 000 nuller etter seg. Og dette er et STORT tall. Dette betyr, at sannsynligheten for å lage den menneskelige genom-sekvensen på ett forsøk er mindre enn 1 dividert på et ett-tall med 2 000 000 000 nuller etter seg.

    Dersom man antar at det utføres en mutasjon hvert sekund i løpet av 5 milliarder år, (jordas antatte levetid), så vil man utføre omtrent 2*10^17 mutasjoner i låpet av jordas levetid. Det betyr at dersom man antar en mutasjon hvert sekund i hele jordas levetid, vil sjansen for å frembringe det mennekelige genomet være mindre enn 1 dividert på (1 000 000 000 -17).

    Jeg kan ikke forstå annet enn at de som fronter evolusjonsteorien umulig kan regne.

  • ali

    Korreksjon til siste setning her: Den skal være sjansen for å frembringe det mennekelige genomet være mindre enn 1 dividert på 10^(1 000 000 000 -17).

  • Arcus

    @Ali: Ditt problem er at du ikke forstår hva du regner på. Evolusjonsprobabiliteter er ikke vilkårlige (arbitrary), men tilfeldige (random), som innebærer at du må ta høyde for at naturen optimaliserer etter forholdene. Det er ikke en blind utvikling, men heller ikke en guidet utvikling, men mer hva vi forbinder med «prøv of feil». F.eks. vil mutasjoner som ikke promoterer tilpasning (fitness) forsvinne raskt mens en som øker den vil raskt videreforplante seg, en mutasjon som fører til sterilitet vil dø ut med bæreren, en mutasjon som øker forplantningsevnen vil øke forplantningsevnen.

    I tillegg er en slik eksersis meningsløs siden man uansett ikke kan beregne sannsynligheter på denne «bakvendte» måten. Sannsynligheten for at den ene sædcellen traff det spesifikke egget som frembragte deg er også relativt lav, tatt i betraktning alle potensielle sammensetninger i verden, og per din matematikk så vil jo det innbære at du ikke kanskje ikke eksisterer? Iallefall vil din (og min) eksistens være så usannsynlig at man strengt talt kan avskrive oss.

  • rajit

    Veldig artig å lese kommentarene (skjønt jeg bare har lest et par). Alle presenter sin overbevisning med stolthet (igjen: trekker mine konklusjoner ut i fra et lite utvalg som tilsvarer 4% av kommentarene). Så da kaster jeg meg på:

    En fargeblind mann observerer et eple med sin ikke-fargeblinde kone. Mannen er overbevist om at eple er grått. Kona, derimot, påstår at mannen har feil: «Eple er rødt»

    Hvem er det som formidler sannheten?: Ingen av dem.

    Konklusjon: Vi alle streifer sannheten, men ingen har virkelig skjønt det/ alle sannheter vi besitter er falske (inkl. min egen)

  • SuperSindre

    Dette svaret kommer seint Karsten, men jeg prøver meg allikevel.

    Jeg er som sagt ikke noen ekspert på verken evolusjonsteori eller ID, men er mer opptatt av hvordan man angriper en teori. Så kudos for at du tar for deg premissene.

    Jeg er imidlertid ikke helt overbevist om argumentene dine.

    Du skriver: «Mutasjoner er naturligvis begrenset av naturlover, men er ellers tilfeldige.»

    Rett under synes du å mene at det er naturlover som styrer mutasjoner:

    «- Mutasjon kan ikke forklares ved lovmessighet. Det er ingen naturlover som styrer mutasjoner (sitat fra mitt innlegg).

    Jo, det kalles fysiske og kjemiske lover. Ikke glem at DNA bare er et stort kjemisk molekyl.»

    Når det gjelder min «epic fail» er den for så vidt ikke min, men ID som teori sin. Du synes å tilbakevise at gjensidig avhengige mutasjoner eksisterer. Dette er en påstand som vil slå benene under store deler av ID som teori og er, slik jeg ser det, det som skiller ID fra konvensjonell evolusjonsteori. Kunne imidlertid vært interessant å høre noen av dine belegg for denne påstanden. Har man eksempler på fosilfunn med primitive øyer med en annen funksjon? Hvis dette var tilfeldige mutasjoner ville det vrimle med «missing links» med uferdige organer, men jeg kan ikke huske å ha lest om noen… Hvis disse ikke eksisterer, hva er da belegget for at evolusjonen må ha skjedd trinnvis?

    Sindre

  • Øyvind

    «Hvis dette var tilfeldige mutasjoner ville det vrimle med “missing links” med uferdige organer, men jeg kan ikke huske å ha lest om noen…»
    Organer har en merkelig tendens til å rammes av forråtnelse, kan det kanskje ha noe med dette å gjøre?
    Og man trenger vel egentlig ikke dra lengre enn til den kulørte presse for eksempler på både mennesker og dyr med uferdige organer?

  • rajit

    Korreksjon: «Kona, derimot, påstår at mannen TAR feil»

  • http://hitthebutton.org Tor Arne Pedersen

    Hvordan kan du påstå at ingen har rett om eplefargen rajit? Fargen kan ikke bare observeres av de som ikke er fargeblinde, men også måles, siden farge er et resultat av hvilken del av stråling fra det synlige elektromagnetiske spekteret som reflekteres. Forsåvidt minner sammenligningen om hele ID-synet her – bevisene fins, men hvis vi tror hardt nok at de ikke fins, så kan vi koke i hop egne teorier og verifisere det hele med at «dette trengs ikke årsaksforklares». Det er forsåvidt helt greit for meg at folk tror på akkurat hva de måtte ønske, ikke like greit at de insisterer på å jobbe som lærer innen fagfelt de ikke helt behersker. Karsten Eig her har vel såpass ettertrykkelig tilbakevist disse alternative sannhetene nå at en repetisjon ikke burde være nødvendig.

  • http://karsteneig.no Karsten Eig

    @SuperSindre

    Mulig at det ble uklart, poenget var at selvsagt kan ikke mutasjoner skje i strid med naturlover, men innenfor rammeverket av naturlover er de tilfeldige.

    Det er riktig som Øyvind skriver at øyne sjelden bevares – men det er mer av nok av forskjellige stadier å observere i naturen i dag, og vi har en god oversikt over hvordan øyet sannsynligvis har utviklet seg:

    http://en.wikipedia.org/wiki/Evolution_of_the_eye
    http://www.freshbrainz.com/2007/12/evolution-of-eye-recent-review.html
    h
    http://www.britannica.com/EBchecked/media/74661/Steps-in-the-evolution-of-the-eye-as-reflected-in

  • http://karsteneig.no Karsten Eig

    @Ali:

    Dette betyr, at sannsynligheten for å lage den menneskelige genom-sekvensen på ett forsøk er mindre enn 1 dividert på et ett-tall med 2 000 000 000 nuller etter seg.

    Dersom man antar at det utføres en mutasjon hvert sekund i løpet av 5 milliarder år, (jordas antatte levetid), så vil man utføre omtrent 2*10^17 mutasjoner i låpet av jordas levetid. Det betyr at dersom man antar en mutasjon hvert sekund i hele jordas levetid, vil sjansen for å frembringe det mennekelige genomet være mindre enn 1 dividert på (1 000 000 000 -17).

    Du viser at du ikke har forstått hvordan evolusjon fungerer, siden du regner med helt vilkårlige mutasjoner uten avhengighet.

    For det første: Med tanke på mengden celler i verden kan det skje millioner av mutasjoner hvert sekund.

    For det andre: Evolusjon virker ikke ved slike uavhengige mutasjoner. Du overser den andre halvparten av mekanismen: Naturlig seleksjon, som sørger for at mutasjoner som gir en fordel tas vare på og gode mutasjoner dermed akkumuleres.

    For a ta en kortstokk som analog:

    Anta at du har en godt stokket kortstokk, der kortene ligger i helt tilfeldig rekkefølge. Du ønsker å sortere kortene i fire bunker (spar, kløver, hjerter, ruter), hver med esset øverst, så kongen, dama, knekten etc. Sannsynligheten for at du stokker kortene slik at de ligger i riktig rekkefølge (først sparesset, så sparkongen og nedover, så det samme for de tre andre fargene) er forsvinnende liten.

    Men, dersom du prøver mange ganger er det sannsynlig at du vil oppleve at det første kortet du trekker er et sparess. I evolusjonsanalogien: en god mutasjon. Derfor bevarer du mutasjonen, du tar esset ut og til side. Så stokker du en gang til. Etter en del forsøk til er det sannsynig at du vil oppleve at det første kortet er sparkongen, som du så tar til side. Etc etc. Jo flere kort som tas ut, jo færre forsøk trengs på de gjenværende kortene.

    Når vi i tillegg vet at det finnes milliarder på milliarder av celler i verden kan du også gjøre eksperimentet med flere milliarder kortstokker samtidig.

    Ser du hvorfor regnestykket ditt ble meningsløst?

  • Jan Oscar Sæbø

    Evolusjonsteorien er fortsatt kun en teori. Den blir ikke mer sann av at du er overbevist om at den er sann. Det finnes ingen bevis, bare indisier som tolkes som bevis av deg som allerede er overbevist om at teorien er sann.

  • http://urblo.no Kenneth Moe

    «If someone doesn’t value evidence, what evidence are you going to provide, to prove that they should value it? If someone doesn’t value logic, what logical argument could you provide, to show the importance of logic?»
    - Sam Harris

    Det er bare å gi opp å forklare Sigve evolusjon. Fokuser heller energien på å vise hvorfor det ikke er et brudd på religionsfriheten å gi ham sparken.

  • http://trondbieblog.wordpress.com Trond Bie

    Den vitenskapelige metode er den mest kritiske og den eneste objektive måten å komme frem til en teori eller en sannhet. Det er i bunn og grunn metodene for å komme frem til noe, eller å prøve å finne ut av noe, de bestrider (trolig uten å være klar over det selv).

    At ID-menneskene fortsatt ikke har fått dette inn i skallen, uansett om de tror på visse teorier eller ikke, er bare trist og skummelt.

    Det er bare for dem å se seg rundt i rommet man er i, og huset man bor i, for å konkludere med at nær sagt alt man vet og har nytte av i dagliglivet har oppstått som en del av en vitenskapelig tilnærming til problemer som måtte løses.

  • http://karsteneig.no Karsten Eig

    @Jan Oscar Sæbø:

    Hvilke argumenter ville du godta for å bli overbevist om at evolusjonsteorien er riktig, og hva skal evt til for å falsifisere den?

    Det finnes et enormt vitenskapelig materiale som støtter teorien: Fossilmateriale, anatomiske sammenlikninger, genetikk og direkte observasjoner av evolusjon i naturen, bl.a. nye arter.

  • Bjarte Skogøy

    @Karsten Eig
    Han praktiserer vel «Jeg tror det ikke før jeg får se det» og «bevisbyrden ligger hos deg»-prinsippet. Som så mange antireligiøse stolt bærer som sin fane.

    Og da finnes det ingen løsning. For man ser bare det man aksepterer å ha sett. Og om du viser han en mutasjon i det virkelige liv finner han like lett en bortforklaring for det, som det er lett å finne bortforklaringer for helbredelse eller andre ikke-vitenskaplig-aksepterte fenomener (hva det nå skulle være).

    Poenget er at uansett hvor objektiv man hevder vitenskapen er, så er det et spørsmål om tro; man må akseptere de premissene som ligger til grunn. Det kan man velge å gjøre eller ikke gjøre.

  • http://www.geeljire09.wordpress.com Mohamed

    Ja, evolusjonsteorien er fortsatt en teori. Hehe.

    Tyngdekraften er også bare en teori, sa den hoppende mannen som fornektet tyngdekraften.

    Det jeg finner urovekkende er at enkelte som har deltatt i diskusjonen burde noe SERIØST sette seg inn i grunnleggende logikk og vitenskapsteori. Plukk opp en bok eller to som forklarer enkelt og konsist vitenskapsteori og grunnleggende logikk.

  • eirik

    Jeg viser til mine tidligere kommentarer @ Sigve, som jeg etter gjentatte spørsmål underlig nok ikke har fått svar på. Jeg vil gjerne vite hvor man kan studere ID, som du vil vi skal ta alvorlig, og som du mener skal konkurrere med evolusjonsteorien:

    «Jeg vil gjerne vite hvor du har studert det du hevder er en vitenskaplig teori om intelligent design. Er det på universitetet i Oslo eller Bergen, eller er det på en høyskole, eller der det et universitet i utlandet du har studert dette?

    Og hvor har du studert evolusjonsbiologi? Jeg mener, før du avviser teorien om evolusjon, av de aller fleste ansett som den mest banebrytende og kraftfulle teorien i vitenskapens historie, har du selvsagt satt grundig i dennes vitenskaplige grunnlag.»

  • Sigve Brekke

    Til Bjarte

    Det var blant de mest fornuftige innspillene så langt. For meg er det et ærlig spørsmål om man vil tro på premissene. Når vi i dag vet hvor kompleks selv de minste enheter i naturen er så føler jeg det er tanketvang å tvinge folk til å tro at livet kan oppstå spontant fra den døde natur. Jeg kan rett og slett ikke tro det er sant.

    Se de fantastiske detaljene i denne animasjonen

    http://www.youtube.com/watch?v=VC_acwviSiA&feature=relmfu

    http://www.youtube.com/watch?v=cK-OGB1_ELE&sns=fb

    Det er jo bare i en celle og vi består av ulike spesialiserte celler som danner organer og organsystemer, for meg er det helt utrolig. Og jeg mener derfor at naturen peker i sterkere grad på et intelligent opphav. Man kan selvfølgelig presse alle fakta inn i en konstruert modell med tilhørende konstruerte begreper som bare er gyldige innenfor modellen, men da må man som det er sakt, velge å akseptere premissene.

    Hør denne debatten og avgjør selv:

    http://www.discovery.org/v/2651

  • eirik

    Når du sier at evolusjon er trosbasert, mener du da at evolusjonsteorien er ufalsifiserbar?

  • Cassanders

    Det er åpenbart at mange som har sterke meninger om dette ikke ser ut til å ha den nødvendige kunnskapsbakgrunnen som skal til for å vurdere de underliggende premissene på en effektiv måte.

    Det får så være, men en kan også drøfte disse spørsålene i en kulturell / filosofisk sammenheng.

    Da anbefaler jeg Stephen Law’s: «Believing Bullshit».

    Dere finner et intervju med S.L. her:
    http://www.newscientist.com/article/mg21028160.200-a-field-guide-to-bullshit.html?full=true

    Cassanders
    In Cod we trust

  • Sigve Brekke

    Svar til Eirik

    Den er falsifiserbar logisk sett, men problemet er at de orginale hypotesene støttes opp av hjelpehypoteser (RNA verden for eksempel). En utfordring med å falsifisere teorien er at man må bruke de samme begrepene som gjelder innenfor teorien. I realiteten blir det derfor vanskelig.

    Fordi man må jobbe innfor rammene som teorien setter bekrefter den seg selv.

  • Yngve B

    Sigve Brekke: Kan du med egne ord forklare den vitenskapelige metode generelt og evolusjonsteorien spesielt for oss? Dette vil hjelpe til å klargjøre på hvilke punkter meningsforskjellene ligger. Det er også i aller høyeste grad relevant i forhold til dine kvalifiaksjoner som naturfaglærer. Hvis det viser seg at du klarer å forklare begge deler på en måte som viser at du har forstått det du kritiserer, så er det mulig å diskutere bevisgrunnlaget for evolusjonsteorien og hvorfor du mener det er utilstrekkelig på en mer fruktbar måte. Ballen er hos deg.

  • Yngve B

    Spørsmål til Sigve: Er Relativitetsteorien ugyldig innenfor sine rammer (gravitasjon osv) fordi den ikke beskriver kvantefysikk?

  • Bjarte Skogøy

    @Mohamed
    Tyngdekraften (at ting faller) er et observerbart fenomen. Hvordan man forklarer det er en teori.

    @eirik
    Jeg mener at uten å være overbevist aksepterer vi ikke. Da kan det være så sant eller usant man bare vil. Man må uansett overbevises. Vi har alle forskjellige kriterier for å nå det stadiet der vi er overbevist, og der har vitenskap den gode egenskapen at den skal være objektiv, og at det ikke er en subjektiv avgjørelse. Den skal bygge på det som kan observeres.

    Når man da som Sigve ikke synes det som er observert er godt nok for å bli overbevist er det jo hans sak. Man kan like det eller ikke. Og det blir noe rart synes jeg når agendaen for ID, iallefall for min del, ser ut til å være å bevise at det må ha vært en skaper, når evolusjonsteorien aldri har eller kan motbevise en skaper. Dersom religion skal være motivasjon for å stille spørsmål ved vitenskap har man havnet på ville veier. Så lenge vitenskap holder seg til å være vitenskap, vel og merke.

    Vi har kanskje havnet i et problem i det at vi tar opplystheten for godt. Kanskje må logikk, vitenskapsteori og kildekritikk inn i skolen på et mye tidligere tidspunkt?

  • eirik

    @Sigve:

    Såvidt jeg kan forstå, så vil det motbevise evolusjonsteorien hvis man finner f.eks. homo sapiens sapiens-fossiler (eller andre moderne skapninger som st bernhardt-hunder) i geologiske lag som plasserer dem tidsmessig med f.eks. dinosaurer. Just from the top of my head.

    Det du sier om evolusjonsteoriens rammer forstår jeg ikke.

    Når jeg spør deg hvor du har studert ID og evolusjonsbiologi, og du bevisst ikke svarer på dette, er det fordi du mener det ikke har noe å si for om ID er en vitenskap?

  • eirik

    @Bjarte:

    «Vi har kanskje havnet i et problem i det at vi tar opplystheten for godt. Kanskje må logikk, vitenskapsteori og kildekritikk inn i skolen på et mye tidligere tidspunkt?»

    Ja!

  • ali

    Karsten Eig skriver:

    «For det første: Med tanke på mengden celler i verden kan det skje millioner av mutasjoner hvert sekund.»»

    Det trenges vanvittig mye mer enn millioner av mutasjoner hvert sekund. Det trenges 10^(10000000000-17) ( et 1-tall me nesten en milliard nuller etter seg) for at hypotesen om evolusjonen er sannsynlig.

    Og analogien med kortstokken holder ikke. La os anta at det menneskelige genomet var på 52 tegn (i virkeligheten er det på ca 3 200 000 000 eller 3,2 milliarder tegn, eksempelvis AATTACTTAGTTTATTTGCTCGATATCTAAGGATAAAATTACTTAGTTTATTT. Det finnes 4^52 eller ca 10^31 = 10 000 000 000 000 000 000 000 000 000 000 forskjellige slike strenger. Jordas antatte levetid er på 5 milliarder åreller omtrent 2*10^17 sekunder. For å frembringe en spesiell streng på 52 symboler på 5 milliarder år vil man derfor trenge rundt 10^31/2*10^17 = 5*10^13 = 5 0 000 000 000 000 mutasjoner hvert sekund. Og det er ikke 52 symboler i DNA-strengen, men 3,2 milliarder symboler. Og argumentet ditt med fordelaktige seleksjoner holder ikke, fordi evolusjonsteorien antar tilfeldige mutasjoner.

    Evolusjonsterorien er satt opp av folk som ikke kan regne. Man behøver ikke å falsifisere evolusjonsteorien. Evolusjonsteorien er falsifisert for lenge side. Matematisk/statistisk er evolusjonsteorien rent sludder.

  • ali

    Til Sigve Brekke: Evolusjonsteorien er falsifisert. Matematisk/statistisk er evolusjonsteorien nonsens. Sludder. Reinspikka idioti. Jeg kan oversende deg et par bøker som viser dette dersom du gir meg en email adresse (eventuelt opprette en hotmail-konto for dette formålet.

  • Yngve B

    ali:

    Jeg legger merke til at du ignorerer resten av inlegget til hr Eig som faktisk adresserer den misforståtte matematikken din. Mutasjoner er tilfeldig (innenfor fysikkens lover) mens naturlig utvalg *ikke* er en tilfeldig prosess. Hver gang en mutasjon skjer i et avkom, og mutasjonen gir dette avkommet en formeringsfordel over andre konkurrerende avkom, så vil mutasjonen overleve til neste generasjon og spre seg i populasjonen. Dette er en naturlig konsekvens av at det er begrenset med resurser i verden. Det er mao du som ikke forstår populasjonsmatematikk.

  • eirik

    @ Yngve:

    Hehehe.. Jeg tror kristne/muslimer blir så forbanna når de leser «»Evolusjon» at de ryker en sikring og glemmer å lese resten: «- gjennom naturlig utvalg».

    Det finnes vel ingen annen forklaring på at de insisterer på at utviklingen har skjedd «tilfeldig».

  • http://karsteneig.no Karsten Eig

    @Ali:

    Du argumenterer mot en stråmann. Du driver fortsatt og regner på sannsynligheten for at et DNA-molekyl skulle bli dannet, fiks ferdig, i en mutasjon. Ingen påstår det. Det naturlige utvalget er mekanismen som sørger for å ta vare på de gode kortene som deles ut av mutasjonene. Mutasjonene er tilfeldige, men evolusjonen er ikke tilfeldig fordi den selekterer ut gode mutasjoner.

    For å si det statistisk: Du regner på ren tilfeldighet, men du må regne på betinget sannsynlighet.

  • http://twitter.com/Nynorskingen LEIÆ’HSIỺI

    Stig skrev 17. januar, 2012 kl. 08:32:

    «Darwin er eit etternamn.»[...]»For min eigen del er skeptisk til Darwinistar med ei fundamentalistisk forsvar av det dei meiner at darwinismen impliserar.»

    @LEIÆ’HSIỺI: Darwin er et etternavn skriver du i ene setningen, og i neste benytter du deg av ‘Darwinist’? Kan du forklare hva en Darwinist er?

    Det fyrste var eit svar på eit påstand. Les påstandet. Men elles: Berre byt ut «darwinisme» med «vitskap som er tufta på dei prinsipp Darwin fann fram til».

    I tillegg, du kjenner sannsynligvis all den overveldende empirien som ligger bak evolusjonsteorien. Kan du liste opp noen vitenskapelige funn som støtter kreasjonisme?

    Eg er ikkje biolog. I mi deltaking i denne debatten er meir oppteken av dei rettslege og saklege sidene av saka – dvs av det eg oppfattar som Sigve si hovudsak i denne artikkelen … Eg les Sigve sitt forsvar for ID med interesse, men når det gjeld «klassisk» kreasjonisme, steller eg meg vel nok so skeptisk.

  • eirik

    @LEIƒHSIỺI

    «Eg er ikkje biolog. I mi deltaking i denne debatten er meir oppteken av dei rettslege og saklege sidene av saka»

    Den saklige og rettslige siden er om Sigve – som forfekter et direkte vitenskapsfiendtlig syn, og som gjentatte ganger viser at han ikke har forstått den vitenskapen han avfeier – bør kunne undervise i en vitenskapsbasert norsk skole.

    I say nay.

  • Yngve B

    @LEIƒHSIỺI:
    Sigves rettigheter i denne saken er avhengig av om han faktisk er i stand til å representere vitenskapen på en objektiv måte eller om han er låst i de tankemønstre han har gitt uttrykk for her. Hvis han er kompetent til å fremstille vitenskapen riktig i naturfagstimene så er han verdig jobben.

    Det Sigve har gitt uttrykk for som kom for skoleledelsens oppmerksomhet gir skoleledelsen skjellig grunn til mistanke for at Sigve ikke er kompetent. Det er denne kompetansen han må overbevise skoleledelsen og oss om at han innehar.

  • Sigve Brekke

    Påstanden om at den vitenskaplige metoden er en metode som gir sikre resultat trinn for trinn er ikke holdbart. Resultater kan være påvirket av ønske om makt og dominans, forfremmelse og karriere, men alt kan selvfølgelig ikke bare koke ned til en slaks ønske om kontroll. Jeg tror absolutt på fornuften og rasjonalitet oppi det hele

    Kan Gud skape en firkantet sirkel: Jeg legger til grunn at Gud er rasjonell (premiss) og at han derfor ikke kan skape en selvmotsigelse (av premissen følger).

    Grunnen til at mange reagerer på ID er at man ønsker å gjøre som positivistene, nemlig å holde vitenskapen fri for metafysiske antagelser. Man sier derfor at det materielle er årsaken til det metafysiske. Jeg mener at det metafysiske er årsaken til det materielle.

    Begrunnelse: Det materielle trenger en årsaksforklaring, det kan ikke komme fra ingenting.

    La oss late som om at observasjoner er uavhengige av teori og at observasjonen derfor er et sikkert grunnlag for kunnskap. Med denne antagelsen kan man arbeide frem ”hauger av beviser” for en gitt teori. For eksempel det geosentriske verdensbildet. Ingen grunn til å tvile, men har hauger av beviser (Induksjon)!!! Her kan man argumentere logisk uten at konklusjonen er sann.

    Darwinister påstår at de har hauger av beviser, men konklusjonen trenger ikke være sann. Jeg vil også påstå at teorien ofte er der før konklusjonen slik at man tolker erfaringene i favør av teorien.

    I slike tilfeller trenger man et eksempel på å falsifiserer teorien, noe man per dags dato ikke har. Så ærlig skal jeg være. Dette er man jo klar over så derfor sier begge parter (Darwinister og ID tilhengere) at konklusjonene er mer eller mindre sannsynlige.

    Man tror også at sannsynligheten for at teorien er sann øker over tid, men mange ganger kan det komme an på øye som ser. Hvilke grunnantagelser man legger til grunn. Og dette er grunnen til uenigheten, man har ulike grunnantagelser!

    I vitenskapen fokuserer man på årsaksforklaringer, og man legger til grunn at det bare finnes naturalistiske forklaringer. Her er vi altså uenige jeg mener man kan finnes algoritmiske forklaringer også. En vulkan kan forklares ut fra naturalistiske forklaringer en steinalderøks har en algoritmisk forklaring. Spørsmålet er om DNA best forklares som en algoritmisk forklaring eller gjennom en naturalistisk årsaks forklaring.

    Det var et intellekt som formet øksen ikke naturlovene eller vær og vind. Ingen vil betvile det fordi kompleksiteten til øksen er før høy. Kanskje livet og universets opprinnelse best forklares best ut fra et intelligent opphav.

    Konsekvensen av å utelukke en forklaring som uvitenskaplig ser man i teorien om multiuniverser. Man tror på små sannsynligheter og har kommet til at det derfor må være mange universer for alle sannsynlige hendelser. Det betyr et i ett univers av de uendelige mange universene sitter det en å kritiserer ID for å dominere lærebøkene fordi det er jo en sannsynlig hendelse selv om noen vil mene at den er ganske liten.

    Jeg vil også påstå at evolusjonsteorien ekstrapolerer og projiserer bakover i tid på noe uobserverbart, riktig nok har man fossiler, men ikke alle fossiler er entydige. Hvordan forklarer man at det plutselig (i geologisk forstand) dukker opp en rekke ulike dyr med stor diversitet. For å unngå tvil konstruerer man hjelpehypoteser som da skal holde forståelsesrammen på plass.

    På kommentarene over ser det ut som at mange søker å bevise evolusjon, men vitenskapen har et annet ideal. Den søker alltid å falsifisere. Stikk motsatt av mange debattanter så langt.

    Jeg tror nok at mange vil innse at det er svært usannsynlig at livet skal ha oppstått av seg selv, men man mener at det ikke finnes noen bedre alternativer enn evolusjonsteorien. Derfor velger man å holde på en forklaring som man kanskje vet ikke egentlig er adekvat, men hvorfor alle følelsene da.

    Til slutt
    En naturfaglærer er ikke kompetent til å undervise i naturfag fordi han ikke tror at evolusjonsteorien er sann.

    Påstanden legger til grunn at det er en direkte sammenheng med evne å formidle og troen på evolusjon.

    Det skal heldigvis ikke så mye til å falsifisere denne hypotesen.

    Sannsynligvis er konkusjonen feil.

  • Sigve Brekke

    Til Ali

    Broder her er min mail sigve_5@hotmail.com

  • http://twitter.com/Nynorskingen LEIÆ’HSIỺI

    @eirik skreiv, den 18. januar, 2012 kl. 15:26:

    Den saklige og rettslige siden er om Sigve — som forfekter et direkte vitenskapsfiendtlig syn, og som gjentatte ganger viser at han ikke har forstått den vitenskapen han avfeier — bør kunne undervise i en vitenskapsbasert norsk skole.

    I say nay.

    Du sjølv drog inn det utvitskaplege påstandet om at det i tidlegare tider var vanleg å tru at jorda var flat.

    No reknar eg difor med at Minerva-redaksjonen kjem til å senda e-post-adressa di til dine arbeidsgjevaren din, slik at vedkomane kan få teke seg ein skikkeleg prat med deg.

  • Arcus

    «Påstanden om at den vitenskaplige metoden er en metode som gir sikre resultat trinn for trinn er ikke holdbart. Resultater kan være påvirket av ønske om makt og dominans, forfremmelse og karriere»

    Det er derfor man har kvalitetssikring via fagfellevurderingsprosessen, nettopp slik at dette ikke skal kun forekomme, ref. f.eks. retraksjonen av Wakefield’s Lancet artikkel ang. MMR vaksine og autisme. Merk også at reproduksjon av resultat av utenforstående er også et krav i den vitenskaplige prosessen, ref. f.eks. kald fusjon debatten. Påstanden du hevder ikke er holdbar er nettopp det, med mindre du også tror at det er en massiv forskerkonspirasjon der ute.

    «Grunnen til at mange reagerer på ID er at man ønsker å gjøre som positivistene, nemlig å holde vitenskapen fri for metafysiske antagelser»
    Stråmannsargument. Jeg reagerer på ID fordi det ikke har noen vitenskaplig fundament og klassifiserer derfor i samme kategori som bl.a. astrologi og homeopati.

    «Begrunnelse: Det materielle trenger en årsaksforklaring, det kan ikke komme fra ingenting.»
    Helt enig. Hvor hevder religionen at ting kommer fra?

    «Darwinister påstår at de har hauger av beviser, men konklusjonen trenger ikke være sann.»
    Uhm..? Det kan jo være tilfellet at tusenvis av forskere i mange disipliner enter tar fullstendig feil eller er medlemmer av en global konspirasjon, men Occam har en innvendelse.

    «Jeg vil også påstå at teorien ofte er der før konklusjonen slik at man tolker erfaringene i favør av teorien. »
    Teorien må være der, dog i den vitenskaplige forståelsen av hva en teori er, siden disse tross alt er utdannede vitenskapsmenn. Jeg antar du sikter til at arbeidshypotesen kommer før observasjon, noe som oftest også er tilfelle siden disse skal da støttes av empiri. Konklusjonen vil følge av hypotesetestingen, man kan ikke bare dra en ut fra løse luften.

    «I slike tilfeller trenger man et eksempel på å falsifiserer teorien, noe man per dags dato ikke har.»
    Jeg ser du griper til Poppers innvending. Joda, evolusjon kan motbevises ved å finne f.eks. restene av et menneske i trias-laget eller at et fullstendig nytt kromosom oppstår fra en generasjon til en annen. At alle observasjoner støtter opp om teorien betyr ikke nødvendigvis at teorien ikke er falsifiserbar, det tyder heller på dens styrke.

    «Det var et intellekt som formet øksen ikke naturlovene eller vær og vind. Ingen vil betvile det fordi kompleksiteten til øksen er før høy. Kanskje livet og universets opprinnelse best forklares best ut fra et intelligent opphav.»
    For det første er teorien om livets evolusjon på jorden og universets opprinnelse over hodet ingenting med hverandre å gjøre. For det andre vet vi at øksen er laget av et menneske fordi det har spor deretter; Vennligst fremlegg guds øks som bevisførsel. «Kanskje» vi burde holde oss til de tingene vi faktisk kan bevise, og siden vi tross alt kan forklare mye av både astronomi og biologi med naturlover burde vi «kanskje» satse på det.

    «Konsekvensen av å utelukke en forklaring som uvitenskaplig ser man i teorien om multiuniverser.»
    Så vidt meg bekjent er ikke multiversteorien utelukket. Siden det kun er matematiske beviser for multivers og lite trolig vi vil kunne understøtte hypotesen med empirisk bevis, så er det korrekt ansett for å være en «tro».

    «Jeg vil også påstå at evolusjonsteorien ekstrapolerer og projiserer bakover i tid på noe uobserverbart, riktig nok har man fossiler, men ikke alle fossiler er entydige.»
    Spesifikt hvilke fossiler?

    «Hvordan forklarer man at det plutselig (i geologisk forstand) dukker opp en rekke ulike dyr med stor diversitet.»
    Høyst sannsynlig på en rekke vitenskaplige måter.. Men hvilken plutselig forekomst av stor diversitet sikter du til? Kambriumeksplosjonen? I så fall finnes det en rekke argumenter, se f.eks. S.J. Gould.

    «På kommentarene over ser det ut som at mange søker å bevise evolusjon»
    Jeg forsøker ikke å bevise evolusjonen, heldigvis behøver jeg ikke det. Alt jeg behøver er å bevise at du tar feil og ID ikke har noen plass i skoleverket.

    «Jeg tror nok at mange vil innse at det er svært usannsynlig at livet skal ha oppstått av seg selv»
    Stråmannsargument.

    «Derfor velger man å holde på en forklaring som man kanskje vet ikke egentlig er adekvat, men hvorfor alle følelsene da.»
    Fordi det er kanskje noen som ikke ønsker at religion blir del av skoleverket i større grad enn i dag, at våre barn ikke blir lært svada da det finnes nok av andre ting de kunne lært, og generelt at ID er pisspreik…
    ———
    Se forøvrig vitenskapsjournalisten Peter Hadfield sin gode og raske gjennomgang i sin «Made Easy» serie: http://www.youtube.com/watch?feature=player_profilepage&v=7w57_P9DZJ4

  • eirik

    @LEIƒHSIỺI

    «Du sjølv drog inn det utvitskaplege påstandet om at det i tidlegare tider var vanleg å tru at jorda var flat.»

    Nei, det gjorde jeg slett ikke, og jeg begynner å bli rimelig trett av strå her.

    Enten lyver du, eller så kan du ikke lese. Siden du nå har hevdet dette 2 ganger nå, må jeg nesten anta at du lyver. Trist.

  • Sigve Brekke
  • Yngve B

    @Sigve:
    Det er mye rart i det siste innlegget ditt, men jeg vil bare henge meg opp i én ting akkurat nå. Du sier:
    «Til slutt
    En naturfaglærer er ikke kompetent til å undervise i naturfag fordi han ikke tror at evolusjonsteorien er sann.

    Påstanden legger til grunn at det er en direkte sammenheng med evne å formidle og troen på evolusjon.

    Det skal heldigvis ikke så mye til å falsifisere denne hypotesen.

    Sannsynligvis er konkusjonen feil.»

    Dette er ikke det som har blitt argumentert av dine opponenter, ihvertfall ikke av meg. Hadde du representert oss riktigere hadde du kanskje gitt påstanden som:
    «En naturfaglærer er ikke kompetent til å undervise i naturfag når han/hun ikke forstår evolusjonsteorien.»
    Ser du forskjellen?

  • eirik

    @ Sigve:

    Hvorfor tror du at ID er forbudt å undervise i den offentlige skole i USA, jf. Dover-saken mv., og at ID ble karakterisert som religion i forkledning?

    Er det fordi ateister har overtatt USA?

  • Sigve Brekke

    Jeg forstår evolusjonsteorien, men det har ikke ført til at jeg tror på den i dag. Jeg trodde på den da jeg var 12 år fordi jeg ikke hadde forutsetninger for å ikke tror på den.

    Evolusjon:

    Evolusjonsbegrepet er en samlebetegnelse på mikroevolusjon og makroevolusjon. Mikroevolusjon er en kontinuerlig endring innenfor gensekvensen. Når vitenskapsfolk sier at de har mangfoldige beviser for evolusjon eller solide empiriske indisier er det denne kontinuerlige endringen det siktes til (Meyer, Minnich, m.fl. 2007). Makroevolusjon derimot er en tenkt utvikling på tvers av alle artsgrensene fra en enkel urcelle.

    Siden 1859 ble Darwins teori etter hvert tilpasset nye vitenskaplige fremskritt innenfor paleontologi og genetikk, derfor navnet neodarwinismen. Neodarwinismen sier i hovedtrekk at det bare er de mest gunstige egenskapene fra overproduksjonen som får leve videre i populasjonen på grunn av naturlig seleksjon og mutasjoner (Hågvar, 2004). Dette kalte Darwin for naturlig utvalg. Det naturlige utvalg ble etter hvert feilsitert som den sterkeste rett.

    Naturlig seleksjon har den egenskapen at den velger bort informasjon i DNA. For eksempel vil rovdyr spise flere hvite harer om vinteren dersom snøen ikke kommer. Om denne endringen er konstant vil de individene som tilfeldigvis ikke fikk like hvit farge den vinteren ha bedre forutsetning til å føre sine egenskaper videre (Hågvar, 2004).

    Egenskapene som var gunstig når det var vinter kan likevel overleve innbakt i populasjonens totale DNA bank, og på den måten komme til uttrykk igjen dersom snøen kommer tilbake (Meyer, Minnich, m.fl. 2007). Endringer som varer over tid kan fungere som en sil som filtrerer bort enkelte alleler, det vil si en bestemt egenskap som for eksempel farge eller størrelse knyttet til en bestemt plass på kromosomet. Dermed blir populasjonens genetiske bank fattigere på grunn av naturlig seleksjon.

    De tilpassede egenskapene kommer ikke fra silen (endring i naturlig leveområde), men finnes allerede i populasjonen. Derfor er genetisk mangfold viktig for tilpasningsevnen og dermed evolusjon i følge teorien, men hvor mangfoldig var arvematerialet til den første tokjønnede planten?

    Teorien sier lite om denne barrieren for utvikling av nye arter.
    Det er gunstig for tilpasningen til en art at endringer i miljøet skjer gradvis slik at naturlig seleksjon rekker å fremelske egnet informasjon som ligger i populasjonens samlede DNA materiale (Spongenberg.dk, 05.11.09).

    Professor Trygve Gjedrem har gjennom sin forskning vist at bestanddelen av ørret som døde ut i Norge på grunn av sur nedbør kunne ha overlevd dersom denne endringen hadde skjedd gradvis.

    Mutasjoner er som regel skadelige, men i svært sjeldne tilfeller kan det oppstå en gunstig egenskap som naturlig seleksjon kan bevare ved å velge bort andre egenskaper til fordel for den nye mutante egenskapene (Hessen, Lie, Stenseth, 2008).

    Utvandring og innvandring kan også påvirke mangfoldet i populasjonen. I en mindre populasjon er det større sannsynlighet for at endringer i gensekvensen hos bare noen få individer senere vil komme til å dominere populasjonen (Hågvar, 2004). Dette kalles for genetisk drift, men arten står i fare for innavl dersom antall individer når et kritisk lavt nivå. Teorien om genetisk drift er ikke darwinistisk.

    Mikroevolusjon er vanlige hendelser i naturen og har derfor blitt godt dokumentert gjennom observasjoner. Derimot finnes det ingen missing link eller overgangsform som klassifiseres som makroevolusjon, altså store endringer i hvordan en opprinnelig art er satt sammen. I dag vet vi om 2,5 millioner forskjellige fossile arter og ingen mellomformer (Andreassen, 2009). De fleste biologer er allikevel enige om at mikroevolusjon peker på at makroevolusjon må ha funnet sted selv om det fleste kroppsformer plutselig oppstod i den kambriske eksplosjonen. Noen hevder at vi ikke trenger mellomformer, men allikevel leter man etter dem.

    For å plassere artene i en tenkt utvikling fra en primitiv fortid og frem til i dag ser biologene etter likheter mellom ulike arter i forhold til miljøtilpasning, organer med samme funksjon eller organer med samme embryonale opphav (Hågvar, 2004).

    Innenfor evolusjonsteorien finnes det ingen forklaring på hvordan makroevolusjon har foregått, men man ser eksempelvis for seg at på et tidspunkt må encellede organismer ha godt over i flerecellede organismer og organiseringen av celler må på et tidspunkt ha dannet vev. Hva med overgangen fra krypdyr til pattedyr?

    Darwin tilhengernes hjelpehypotese på dette spørsmålet er at grensene ikke var like skarpe før i tiden.

  • eirik

    Hvor har du studert ID da?

    Er det fordi det er flaut å erkjenne at det er noe du har lest på internett at du nekter å svare på dette?

  • Sigve Brekke

    P.s I naturfagsundervisningen i videregående kommer jeg til å holde meg til fremstillingen i læreboken, men i andre sammenhenger vil jeg kritisere fremstillinger som jeg ikke er enig i. Om man ikke stoler på meg så er det ikke mitt problem. Man bør nok anta at sannsynligheten er veldig lav for at jeg trekker inn noe i klaserommet som kan relateres til ID når jeg velger å være så åpen på nett.

  • Arcus

    For å illustrere absurditeten, hva ville vært reaksjonen om innledningsspørsmålet var som nedenfor?

    «Er det problematisk å ikke tro på Holocaust og samtidig undervise i historie?»

  • Yngve B

    Beskrivelsen din over begynner ikke så verst, men degenerer ganske fort ned i standard halvtenkte ID-/kreasjonist-tanker. Distinksjonen din mellom mikro- og makroevolusjon er falsk. Man kan godt kalle det mikro- og makroevolusjon for å tydeliggjøre hvilke størrelsesordener man snakker om, men makroevolusjon er tross alt bare mikroevolusjon som får foregå over lang tid. Å si at man har funnet 2.5 mill forskjellige fossiler, men at ingen av disse er mellomformer er å bomme fullstendig på poenget. I og med at fossilisering er en sjelden begivenhet kan man ikke forvente å finne alle generasjonene som eksisterte mellom hver art som opptrer i forskjellige lag. Men når man kobler fossiler med genetisk analyse, og samtidig kobler dette igjen til geologien og platetektonikk så tegner det seg et ganske vakkert bilde av hvordan alt liv henger sammen.

    Forøvrig er det prisverdig at du forsøker å sitere i teksten din. Om det er bøker, nettpublikasjoner eller fagfellevurderte tekster du siterer er ikke så lett å vite all den tid du ikke legger ved en liste over hva du siterer med titler osv. Hvem er Hågvar og Andreassen for eksempel?

    sitat: «Innenfor evolusjonsteorien finnes det ingen forklaring på hvordan makroevolusjon har foregått, men man ser eksempelvis for seg at på et tidspunkt må encellede organismer ha godt over i flerecellede organismer og organiseringen av celler må på et tidspunkt ha dannet vev. Hva med overgangen fra krypdyr til pattedyr?»

    Du kan ikke bare fastslå dette kan du vel? Du kan vel begynne å lete her: http://courses.cit.cornell.edu/biog1101/outlines/Bonner%20-Origin%20of%20Multicellularity.pdf

  • Yngve B

    Når det gjelder makro/mikro så kan man begynne her: http://www.talkorigins.org/faqs/macroevolution.html

  • eirik

    Levde tyrannosaurus rex, mennesker og st bernhards-hunder samtidig for 3,5 milliarder år siden, Sigve?

    (Siden alt visstnok ble skapt samtidig, og det er alderen på de eldste fossilene)

  • Yngve B

    ID kan jo sikkert også referere til en intelligens som hele tiden fikler med skapelsen sin. Med periodiske utrenskninger som f.eks Kritt-Tertiær, Tria-Jura, Perm-Tria osv. «Jeg får ikke til å lage mennesker! Argh, jeg må visst utrydde 83% av alle arter for å forsøke på nytt. Nei søren, forsøker på nytt… Nei… Nye dyr… nei. Kanskje jeg kan flytte kontinentene… litt bedre. Pokker….(…)» Und so weiter, und so weiter ad infinitum.

  • Sigve Brekke

    Spørsmål som helt klar antar at jeg har et kreasjonistisk ståsted eller trekker inn helt nye debatter, er på siden av hva jeg gidder å svare på.

    Derimot gir jeg gjerne bort noen linker til den som vil gå mer i dybden på dette.

    http://origonorge.no/

    http://discovery.org/

    http://arn.org/

    Anbefaler å bestille bøker gjennom amazon.com :)

    Debatten går mot slutten for min del. Jeg kommer nok til å svare om det dukker opp noen spørsmål som ikke er belyst eller har ny relevans. Mener du jeg burde svare så kan det hende man finner svar i teksten over.

    Mvh Sigve Brekke.

    Takk for diskusjonen :)

  • Yngve B

    Men du kan vel likevel kort forklare hvordan du forklarer alle artene som har eksistert, men som ikke eksisterer lenger.

  • eirik

    Ble vi ikke skapt samtidig da? Er det ikke det ID sier?

    Hvis man avfeier evolusjon, da må vel alle vesener ha oppstått ferdig utviklet?

  • N.A

    Eirik og Yngve B. sine spørsmål er svært relevante.

    De peker i realiteten på at om ID hypotesen er korrekt så står vi overfor et grunnleggende uforutsigbart univers. Dvs. at den ”Intelligente Designeren” når som helst kan beslutte seg for å utslette mange arter og/eller skape mange nye arter. For Sigve må det derfor være slik at det prinsippielt når som helst kan komme — fra det store intet — en rekke nye skapninger rett utenfor hans egen stuedør.

    Med en slik ontologi vil naturlover og vitenskapelige forklaringer ikke reelt eksistere, enhver stabilitet i mekanismer eller observasjoner vil være et resultat av den ”Intelligente Designernes” vaner og kontingente beslutninger. (Dette er for øvrig påfallende likt den teologiske ontologi som vant frem innen Islam på 1000-1100 tallet, og som er en viktig forklaring på den Islamske verdens tilbakeståenhet innen forskning og utvikling generelt. Når enhver hendelse umediert skyldes Allah (eller en eller annen designer), så er det meningsløst ja til dels blasfemisk å forske på naturlover. Ref. også Robert Reillys utmerkede ”The Closing of the Muslim Mind).

    Når Sigve tror på ID og samtidig studerer og underviser i naturvitenskap er det selvrefererende inkonsistent. Han burde finne seg andre og mer meningsfylte interesser med en slik underliggende ontologi. For eksempel kunne han begynne å studere, eller ”forske” på den Intelligente Designeren for å finne ut mer om hans natur, tilbøyeligheter etc. , dette faget pleier å kalles teologi og finnes i en rekke konkurrerende retninger …

    Derimot er det fullt mulig å være religiøs og tro på evolusjonsteorien, men da har man en ontologisk forutsetning om at gud har skapt mekanismer og lovmessigheter som opererer uten hans direkte inngripen. Dette er for eksempel de ontologiske (og teologiske) forutsetninger som Gallilei og Kepler la til grunn, og som den katolskekirke har sluttet seg til i tilfellet evolusjon.

  • Sigve Brekke

    Det er riktig at jeg er teist og ikke deist og jeg tror skaperen bak all materie nårsomhelst kan gå inn å gjøre modifikasjoner.

    Det er mye i naturfag som fasinerer meg. Det er ikke slik at naturfag bare handler om evolusjon.

    http://www.udir.no/no/Lareplaner/Grep/Modul/?gmid=0&gmi=158615

    Man underviser i Forsker-spiren, Bære-kraftig utvikling, Ernæring og helse, Stråling og radio-aktivitet, Energi for framtiden, og Bio-teknologi

    Da er det bare det siste punktet som man kan støte på utfordringer i forhold til dette vi har sanakket om.

    Det er riktig at naturalismen forutsetter evolusjon, mens kriste tro ikke gjør det. Dersom man tar en titt i populærvitenskapligge fremstillinger blir kirken nærmest latterliggjort. Noen av disse fremstillingene er også foreslått som undervisningsmateriell.

    I en ideel verden kunne jeg latt min lille tiltro til hva naturlig seleksjon kan utrette blitt værende mellom meg og Gud, men et voksende antall ateister ser ut til å bruke vitenskapen til ikke bare å studere naturen, men også kritisere religion. Mange av disse fremstillingene er dypt provuserende. Da er det på sin plass og kaste ut motsvaret i offentligheten.

    På en måte har det eksistert en fred mellom religion og vitenskap i de siste 150-200 år. Jeg tror ikke min generasjon vil sitte stille å se på at ateister latterligjør religiøse. Jeg vil påstå at mange naturalister har skapt sitt eget problem. Ikke bare når det gjelder ID, men også fundamentalisem. Polariseringen mellom religion og vitenskap har til di grader skapt grobunn for fundamentalisme (min egen analyse, men jeg ser andre også har gjort denne slutningen). Mye av dette tar jeg avstand fra, men ID er en plausibel hypotese.

  • eirik

    «Jeg tror ikke min generasjon vil sitte stille å se på at ateister latterligjør religiøse.»

    Jeg tror ikke min generasjon vil sitte stille å se på at religiøse latterliggjør vitenskap. Blant annet derfor er ID forbudt å undervise i skolen i USA.

  • http://karsteneig.no Karsten Eig

    @Sigve Brekke

    Om forholdet mellom religion og undervisning: I utgangspunktet er jeg enig i at så lenge du holder deg til pensum bør du kunne undervise, siden vi ikke skal ha tankepoliti i Norge. Men dersom du kommer trekkende med ID i timene vil jeg være like for at du fjernes fra undervisningen.

    Jeg er også enig i at det er en tendens, eksemplifisert av ny-ateistene, til å gjøre narr av religion og som en ond kraft mot fornuften. Saken er nok litt mer komplisert enn det. Men, det er altså ikke manglende respekt for rligion å motsi den. Du kan gjerne velge dine meninger, men du kan ikke velge dine fakta.

  • http://karsteneig.no Karsten Eig

    Da har jeg sett de to korteste videoene. Salig blanding av fakta, forvrengninger og ren bullshit.

  • http://karsteneig.no Karsten Eig

    @Sigve Brekke:
    Påstanden om at den vitenskaplige metoden er en metode som gir sikre resultat trinn for trinn er ikke holdbart. Resultater kan være påvirket av ønske om makt og dominans, forfremmelse og karriere, men alt kan selvfølgelig ikke bare koke ned til en slaks ønske om kontroll. Jeg tror absolutt på fornuften og rasjonalitet oppi det hele

    Jeg deler beundringen for verdens storhet og livets kompleksitet, men at du føler at dette peker på en skaper beviser ingenting. Vitenskap finner svar gjennom empiri og logikk, ikke følelser. I tillegg serverer du en del, unnskyld uttrykket, oppgulp av postmodernistisk vitenskapsrelativisme, der selvfølgelige innsikter om vitenskapelig prosess dras ut i det absurde. Selvsagt er forskere mennesker, selvsagt finnes det maktkamp og subjektivitet. Men, som du selv skriver, fornuft og rasjonalitet er tross alt fremtredende, det kan ikke brukes til å bortforklare 150 års akkumulerte beviser for evolusjon fra biologi, geologi, genetikk og medisin. Årsaken er vitenskapens anarkistiske natur: Hundretusenvis av forskere i tusenvis av institusjoner og selskaper over hele verden er umulig å gjete (å gjete forskere er som å gjete katter), dermed vil det bli umulig å undertrykke en vitenskapelig posisjon over tid hvis den understøttes av empiri. Argumentet om at ”hvor man sitter viser hvor man står” holder derfor ikke. Da ender du opp med en relativisme der alt er subjektivt, der anything goes.

    Grunnen til at mange reagerer på ID er at man ønsker å gjøre som positivistene, nemlig å holde vitenskapen fri for metafysiske antagelser. Man sier derfor at det materielle er årsaken til det metafysiske. Jeg mener at det metafysiske er årsaken til det materielle. Begrunnelse: Det materielle trenger en årsaksforklaring, det kan ikke komme fra ingenting.

    Problemet med å trekke metafysikk inn i vitenskap er ikke eksistensen av en gud. Det er at straks man begynner å trekke inn gud som forklaring, har man en unnskylding for ikke å forske videre — det er en showstopper.

    Påstanden om at det materielle ikke kan komme fra ingenting høres overfladisk plausibel ut, men er bare et gud i hullene-argument. Gitt dagens forskningsstatus koker det ned til spørsmålet om årsaken til Big Bang, årsaken til at noe i det hele tatt eksisterer. Det vet vi ikke, forsker vi videre finner vi det kanskje ut, selv om jeg har vanskelig for å forstå hvordan man skulle kunne finne ut hva som skjedde før tid og eksistens eksisterte. Men forskning har overrasket før, hvis vi slår oss til ro med gud finner vi det garantert ikke.

    For eksempel det geosentriske verdensbildet. Ingen grunn til å tvile, men har hauger av beviser (Induksjon)!!! Her kan man argumentere logisk uten at konklusjonen er sann. (…) I slike tilfeller trenger man et eksempel på å falsifiserer teorien, noe man per dags dato ikke har.

    Det geosentriske verdensbildet er et godt eksempel på en etablert hypotese som passet med empirien den gang, men som måtte gi tapt i lys av ny informasjon. Og som det tok lang tid å slå gjennom. (Jada, kom gjerne med Semmelweiss og Galileo også). Historien er en viktig påminnelse om ikke å tro at vi vet alt. Det gjør vi da heller ikke, vi vet ikke hvordan livet ble til. Derfor forsker vi videre, i stedet for å bruke en skaper som ad-hoc-hypotese. Kanskje vil man finne noe som snur opp ned på biologien, på same måte som platetektonikken snudde opp ned på geologien på sekstitallet. Dersom man, som allerede nevnt, skulle finne fossiler som er fullstendig malplassert i lagrekka ville det være et seriøst problem for evolusjonsteorien. Men nettopp det at slike ikke er funnet er et godt argument for at den stemmer.

    Spørsmålet er om DNA best forklares som en algoritmisk forklaring eller gjennom en naturalistisk årsaks forklaring.

    Men denne algoritmen finnes jo! Den kalles mutasjoner og naturlig seleksjon! Den er riktignok ikke skrevet av en programmerer, men mekanismen er der like fullt.

    Hvordan forklarer man at det plutselig (i geologisk forstand) dukker opp en rekke ulike dyr med stor diversitet.

    Har du forlest deg på kreasjonistlitteratur om den kambriske ”eksplosjonen”? Les og lær fra pkt 6 i linken her: http://skepsis.no/blog/?p=3099

    På kommentarene over ser det ut som at mange søker å bevise evolusjon, men vitenskapen har et annet ideal. Den søker alltid å falsifisere.

    Hvordan vil du falsifisere ID eller skapelse? Det er jo umulig å bevise at Gud ikke har blandet seg inn. Evolusjonen står på egne ben, den trenger ikke Gud, men det er jo umulig å motbevise at en gud trekker i trådene gjennom naturlovene. Muligens med det unntaket som Yngve B allerede påpeker: De store masseutryddelsene som har skjedd er fullt forenlige med naturkatastrofer, men blir merkelige i lys av en allmektig designer.

    I dag vet vi om 2,5 millioner forskjellige fossile arter og ingen mellomformer (Andreassen, 2009). De fleste biologer er allikevel enige om at mikroevolusjon peker på at makroevolusjon må ha funnet sted selv om det fleste kroppsformer plutselig oppstod i den kambriske eksplosjonen. (…) Hva med overgangen fra krypdyr til pattedyr?

    De fleste kroppsformer oppsto ikke i den kambriske eksplosjonen. Rekkene oppstår da, men fisk oppstår i kambrium, amfibier i devon, strålefinnefisk i jura, reptiler i karbon, dinosaurer og pattedyr i trias, fugler i jura, primater i paleocen. Etc etc.

    Påstanden om manglende mellomformer er nok den mest kjente og kjære av kreasjonistpåstander og den er grundig tilbakevist. Les fra pkt 7 her: http://skepsis.no/blog/?p=3099

    (Opprinnelig innlegg forkortet etter ønske fra Minervaredaksjonen)

  • Hans-Petter Hvile

    En bedre forklaring på det absurde i religion og gudstro har jeg ikke ofte sett.

    Siden skaperen ikke er av materie og aldri har kommet inn i tilværelsen trenger ikke gud en årsaksforklaring.

    Tåkete tanker og forestillinger fordrer gjerne like tåkete forklaringer.

  • Sigve Brekke

    Det er lov å mene hva man vil og jeg mener ID forklarer naturen bedre enn de fremstillingene av evolusjon som jeg er blitt indoktrinert med oppgjennom skolegangen.

    For å overbevise meg bør man hoste opp noe mer en ignoranse.

    Vitenskap er et fint redskap til å forstå vår verden, men å forstå hvor vi kommer fra er det ikke like meningsfull, gitt at man ikke blånekter for muligheten for at det faktisk finnes et intelligent opphav.

    Forslag til å teste ID er gitt i følgende link:

    http://www.uncommondescent.com/biology/id-foundations-15a-a-testable-id-hypothesis-front-loading-part-a-a-guest-post-by-genomicus/?utm_source=feedburner&utm_medium=feed&utm_campaign=Feed%3A+uncommondescent%2FJCWn+%28Uncommon+Descent%29&utm_content=Netvibes

  • Sigve Brekke

    Når jeg sier at vitenskapen ikke er adekvat for å forstå vår opprinnelse mente jeg vitenskapen som begrenser seg til en naturalistisk forklaring. Hva som er vitenskap er et definisjonsspørsmål som makthavener bestemmer i stor grad.

  • ali

    Karsten Eig skrev:

    «For å si det statistisk: Du regner på ren tilfeldighet, men du må regne på betinget sannsynlighet.»

    Dette er bare tull. Det som er poenget, er at mutasjonene er tilfeldige. Evolusjonister vil måtte forklare hvordan man kan endre DNA-et til en art og komme opp med en ny og forbedret art basert på tilfeldige mutasjoner.Sålenge som mutasjonene er tilfeldige (som evolusjonsteorien påstår), så har dette ingenting med betinget sannsynlighet å gjøre. Dette at utvelgelsen av nye arter ikke er tilfeldig har ingenting med saken å gjøre, så lenge som mutasjonene er tilfeldige.

    Evolusjonsteorien ble falsifisert da DNA-et ble oppdaget i 1953, eller senest da det menneskeliget genomet (DNA-sekvensen) ble kartlagt i 2003. Det menneskelige genomet består av fire lignende kjemikalier (kalt baser eller nukleotider) som forkortes A, T, C og G. Det menneskeliget genomet er kodet som en streng på 3,2 milliarder tegn bestående av de fire tegnene A,C,G og T.

    Rent matematisk er dette interessant fordi man kan beregne antall mulige DNA-strenger, som er 4^3200000000 eller rundt 10^1000000000, det vil si et 1-tall med en milliard nuller etter seg. Jeg kan ikke skrive ut dette tallet i dette innlegget, fordi med den fonten som Minerva bruker, så vil dette tallet bli rundt 1 2000 kilometer langt, det vil si at dette tallet utskrevet vil bli omtrent like langt som avstanden Oslo-Bodø. Så man forstår at dette er et stort tall.

    Jordas antatte levetid er på rundt 5 milliarder år eller rundt 2*10^17 = 2 00 000 000 000 000 000 sekunder. De som forsvarer evolusjonsteorien påstår at dette er et vanvittig stort tall, og at evolusjonsteorien har hatt «oseaner av tid» på å virke, men matematisk/statistisk er ikke 2*10^17 = 2 00 000 000 000 000 000 noe spesielt stort tall. Selv om man antar en million mutasjoner per sekund, så får man ikke mer enn 2*10^23 = 2 00 000 000 000 000 000 000 000 mutasjoner i løpet av jordas levetid. Ja, selv om man antar en billion (= en million million) mutasjoner per sekund, så får man ikke mer enn 2*10^29 = 2 00 000 000 000 000 000 000 000 000 000 mutasjoner i løpet av jordas levetid. Sammenlignet med antall mulige DNA strenger, som er omtrent 10^1000000000, det vil si et 1-tall med en milliard nuller etter seg, og som utskrevet med den fonten Minerva bruker vil bli rundt 1200 km langt eller omtrent like langt som avstanden Oslo-Bodø, er dette faktisk et svært lite tall.

    Antall atomer i det observerbare universet er på omtrent 10^80 = 1 00 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000. Man sier vanligvis at en hendelse er umulig dersom sannsynligheten for at hendelsen skal inntreffe er mindre enn antall atomer i det observerbare universet, det vil si mindre enn 1/10^80 = 1 / 1 00 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000. Sannsynligheten for at utviklingen av livet på jorda kan ha foregått på den måten evolusjonsteorien beskriver er MYE mindre enn 1/10^80 = 1 / 1 00 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000. VANVITTIG MYE MINDRE, FAKTISK.

    Litt artig å lese innleggene fra forsvarerne av evolusjonsteorien, Minervas lallende idioter, som ikke vil klare å legge sammen 2+2 om de fikk en million år på seg.

    Til Sigve: Jeg har oversendt bøkene. Gi meg et hint dersom du ikke har mottatt bøkene.

  • http://karsteneig.no Karsten Eig

    @Sigve Brekke:

    jeg mener ID forklarer naturen bedre enn de fremstillingene av evolusjon

    Det vikktige her er begrunnelsen for å støtte ID. Jeg har altså påvist at to av de viktigste argumentene dine for ID – den kambriske «eksplosjonen!» og manglende overgangsfossiler – rett og slett er feil. Noen kommentarer?

    For å overbevise meg bør man hoste opp noe mer en ignoranse.

    Merkelig utsagn, siden ID i sin kjerne er basert på ignoranse, å ta det vi ikke vet til inntekt for en designer.

    Vitenskap er et fint redskap til å forstå vår verden, men å forstå hvor vi kommer fra er det ikke like meningsfull, gitt at man ikke blånekter for muligheten for at det faktisk finnes et intelligent opphav.

    Vitenskapen nekter ikke for muligheten av et intelligent opphav. Men det er altså foreløpig ikke noe empiri for det. (Hvis evolusjonsteorien faktisk hadde vært falsifisert kunne vi kanskje begynt å snakke ID, men foreløpig er altså alle disse påståtte falsifiseringene misforståelser, usannheter eller gud i hull.

  • http://karsteneig.no Karsten Eig

    @Sigve Brekke:

    Hva som er vitenskap er et definisjonsspørsmål som makthavener bestemmer i stor grad.

    I diktaturer kanskje. Vitenskap i akademia er derimot temmelig anarkistisk, i en slik grad at det ikke ville være mulig for noen makthavere å undertrykke avvikende stemer over tid, dersom argumentene deres holdt.

    Jeg underslår ikke at vitenskapen er full av egoer, maktkamp, undertrykkelse av konkurrerende ideer etc. Poenget er at anarkiet gjør at slike maktkamper ikke har mulighet til å sperre for nye, riktige ideer over tid. Før eller siden vil det tyte ut og slå gjennom.

  • eirik

    @ Ali:
    «Litt artig å lese innleggene fra forsvarerne av evolusjonsteorien, Minervas lallende idioter, som ikke vil klare å legge sammen 2+2 om de fikk en million år på seg. »

    Hvis evolusjon ble matematisk motbevist på 50-tallet, hvor kan jeg finne fagfellevurderte forskningsartikler om dette? Og hvem fikk Nobelprisen for denne sensasjonelle oppdagelsen?

    Eller undertrykker de allmektige og onde ateistene (og Minervas lallende idioter) ordinær matematikk?

  • http://karsteneig.no Karsten Eig

    Når det gjelder linken om «front loading»: Nå begynner det å kanskje likne noe. Med forbehold om at jeg er geolog, ikke genetiker: HVis man viser at bestemte gener har eksistert helt livets begynnelse, som om de er programmert til å utvikles videre, kan det indikere at informasjonen er tilført fra en ekstern kilde. Det vil imidlertid være vanskelig å bevise, siden vi ikke har gener fra de eldste celler. En alternativ hypotese ville være svært rask evolusjon, men det kunne nærme seg en farlig ad-hoc-hypotese.

  • http://karsteneig.no Karsten Eig

    Ali er fortsatt flink til å slenge rundt seg med store tall og mange nuller. Dessverre demonstrerer han at han fortsatt ikke har skjønt det fundamentale med evolusjonsteorien.

    Det som er poenget, er at mutasjonene er tilfeldige. Evolusjonister vil måtte forklare hvordan man kan endre DNA-et til en art og komme opp med en ny og forbedret art basert på tilfeldige mutasjoner.Sålenge som mutasjonene er tilfeldige (som evolusjonsteorien påstår), så har dette ingenting med betinget sannsynlighet å gjøre. Dette at utvelgelsen av nye arter ikke er tilfeldig har ingenting med saken å gjøre, så lenge som mutasjonene er tilfeldige.

    Den betingede sansynligheten ligger i at den andre halvdelen av evolusjon, naturlig utvalg, vil ta vare på de mutasjonene som fører til endringer som er til fordel for organismen. Dårlige endringer vil bli forkastet ved at organismen ikke får formert seg, siden dens overlevelsessjanse er mindre. Dermed trenger ikke alle mutasjoner for å føre til en forbedring skje på en gang, de kan akkumuleres. Videre er det ikke gitt at det DNA som faktisk eksisterer i dag er det eneste mulige, livet kunne godt utviklet seg med en annen biokjemisk kode. Tallet for antallet mulige DNA-strenger er derfor fullstendig irrelevant.

    (Feil formatering i forrige innlegg. Kan slettes. Sorry!)

  • Sigve Brekke

    Til Ali

    Fikk ikke bøkene.

    Det er jo litt artig at man kan sende bøker på mail. Det går jo an fordi informasjon er metafysisk. En naturalist som nekter å tro at en intelligent kilde er forklaringen (i dette tilfelle Ali) ville vært nødt for å forklare informasjonen som et resultat av en tilfeldig interaksjon mellom fysiske objekter i en opptisk kabel, men i dette tilfelle vil nok det fleste gå ut av sitt naturalistiske trangsyn og konkludere med en intelligent kilde.

  • Sigve Brekke
  • Bjørn Ove Sætre

    Sigve: Utifra dine argumenter og din måte og argumentere på antar jeg at du kjenner til Norges mest høyrøsta kreasjonist Peder Tyvand. Hva synes du om dette utsagnet fra ham:

    «Jeg vet om folk som har studert biologi med bakgrunn i et kritisk syn på evolusjonsteorien, mens de etter endt doktorgrad har støttet seg til evolusjonsteorien. Hva er det som egentlig skjer i de akademiske kulissene? undrer professor i fysikk på Universitetet for miljø- og biovitenskap på Ås, Peder Tyvand.»

    http://universitas.no/kultur/46649/-darwinmonopol-pa-uio/hl:Tyvand

  • Sigve Brekke

    Til Bjørn

    Svartmaling av enkeltpersoner holder ikke som et argument mot min argumentasjon.

    Du bør sette deg inn i informasjonsbegrepet ved å klikke deg inn på linken over. Det er faktisk avgjørende for å kunne fortsette diskusjonen.

    ps, du kan lukke ører og øyne i de 30 innledende sekundene. Han tar nemlig utgangspungt i noen bibelsitater.

  • Halvard

    @Sigve
    Du linker mye til den kristen konservative think tanken Discovery Institute her i Seattle. Det styrker ikke akkurat din sak da det ikke er tvil om at Discovery Institute’s Center for Science and Culture ikke driver med forskning, men har en agenda om aa spre kreasjonisme under et nytt navn. Hvem er det som gir penger til Discovery, ekstremt konservative kristene organisasjoner.

    Dette er en god video om Discovery http://www.youtube.com/watch?v=sxw3wkOuCys

    Intelligent Design er per definisjon anti-forskning. Det er IKKE en vitenskaplig teori. Det er kreasjonisme.

  • Doremus

    @ali og statistikkargumentasjonen:

    For to uker siden vant Ole Hansen 7 529 351 kroner i Lotto. Vinnerrekken var 2 – 8 – 13 – 15 – 16 – 22 – 35. Sannsynligheten for at nøyaktig denne rekken skal trekkes er [et veldig stort tall som jeg ikke gidder å regne ut nøyaktig], som er langt høyere enn det totale antall lottotrekninger i både fortid og fremtid. Skal vi da konkludere med at Ole Hansen må ha manipulert trekningen?

  • Bjørn Ove Sætre

    Til Sigve: Svartmalig? Når jeg kaller Tyvand høyrøsta? Eller Kreasjonist? Vennlig spesifiser! Dessuten, jeg har ennå ikke begynt å argumentere mot dine argumenter.
    Noen jeg heller ikke kommer til å gjøre. Jeg er bare nysgjerrig på hva du mener om Tyvands utsagn.

  • Sigve Brekke

    Jeg ser at man er livredd for å prøve å fortsette diskusjonen med en forståelse for informasjonsbegrepet. De tre siste innleggene tilfører ingenting nytt. Se over. Stakkars Discovery . får litt penger av kriste.
    Kilden kritikk er vell og bra. men kan ikke spesifisere en hypotese.

  • Yngve B

    Det er en grunn til at vi ikke gidder å diskutere «informasjon» som et begrep. Det er fordi det er dårlig definert og kun brukes til å kunne flytte målet i løpet av diskusjonen. Men hvis vi skal ned den veien: Hva vil du kalle det når en mutasjon i et gen fører til en duplisering av genet, og dermed en lengre DNA-streng? Hvis denne dupliseringen fører til en endring i phenotyp, er ikke da informasjonsinnholdet i DNA-strengen endret og økt?

  • ali

    Jeg blir kritisert fordi jeg ikke tar hensyn til at seleksjonen ikke er tilfeldig. La oss da først se litt nærmere på hva evolusjonsteorien sier. Evolusjonsteorien sier at det foregår tilfeldige mutasjoner i en organismes genetiske kode, og at gunstige mutasjoner blir bevart på grunn av større overlevelsesevne hos organismen- altså ikke-tilfeldig seleksjon.

    Menneskets genetiske kode ble kartlagt i 2003, og det ble da fastslått at denne koden består av 3,2 milliarder basepar eller nukleotider. Det er bare fire forskjellige basepar, og de kodes med bokstavene A, C, G eller T. Mutasjoner er da endringer i den genetiske koden. Den genetiske koden for chromosome nr 5 starter slik: TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC (Du finner koden ved å gå inn på http://www.ncbi.nlm.nih.gov/projects/genome/guide/human/index.shtml, klikk på chromosome nr 5 og så på Download/Wiev Sequence).

    En mutasjon på chromosome nr 5 kan da foregå ved at en bokstav byttes ut med en annen, for eksempel ved at en T endres til an A, eller at en bokstav blir fjernet, eller at en bokstav blir lagt til.

    En matematiker, statistiker eller informatiker vil umiddelbart få vann i munnen ved synet av denne DNA-strengen. Menneskets DNA-sekvens er en kodestreng, og en kodestreng kan analyseres ved å bruke standard matematiske/statistiske verktøy. Jeg kan jo ikke akkurat skrive noen lang avhandling her, så jeg vil ta to av de mest iøynefallende problemene med evolusjonsteorien som oppstår med en gang man begynner å analysere DNA-strengen.

    For det første: Dersom man analyserer antall forekomster av A, C, G og T i den menneskelige DNA-sekvensen, så finner man følgende interessante tall:
    A utgjør 30.74% av strengen
    C utgjør 19.28% av strengen
    G utgjør 19.24% av strengen
    T utgjør 30.74% av strengen

    Dette er ganske uventet. Husk at det første aksiomet for evolusjonsteorien er at mutasjonene forekommer tilfeldig, det vil si at man skulle forvente at A, C, G og T utgjør ca. 25% hver av strengen. Det hjelper ikke at man sier at seleksjonen ikke er tilfeldig, for så lenge som man sier at mutasjonene er tilfeldige, og at det er like stor sannsynlighet for en A, C, G eller T, så vil hver og en av disse bokstavene utgjøre ca. 25% av strengen. For å få til en fordeling som den ovenfor, må man si at sannsynligheten for en mutasjon til A eller T er vel 30%, og sannsynligheten for en mutasjon til C eller G er vel 19%. Men dette strider mot aksiomet om at mutasjonene skal være tilfeldige.

    For det andre: Det andre aksiomet til evolusjonsteorien sier at seleksjonen er ikke-tilfeldig, og at «godt DNA» derfor blir bevart. Men så lenge som man postulerer at mutasjonene er tilfeldig, så kan jo en tilfeldig mutasjon like gjerne ødelegge «godt DNA» som «dårlig DNA». Jeg vil ikke ta utregningene her, fordi det vil antagelig kjede de fleste, men når man begynner å regne på sannsynlighetene her, så ser man at det overveiende antall mutasjoner vil være negative eller i beste fall nøytrale for organismen. Det er også dette man ser i praksis: Mutasjoner fører til at organismen degenerer, og IKKE til at organismen forbedres. Det hjelper ikke at man postulerer at seleksjonen er ikke-tilfeldig så lenge som man postulerer at mutasjonene er tilfeldige.

    Dette er bare et par av de mest iøynefallende problemene med evolusjonsteorien. Evolusjonsteorien ble falsifisert da den menneskelige DNA-sekvensen ble kartlagt i 2003. Matematiske og statistiske lover viser at evolusjonsteorien er det reneste nonsens.

  • Sigve Brekke

    Jo, men det forutsetter at informasjone er der fra før. jeg benekter ikke at orginal informasjon kan endre seg på grunn av darwinistiske mekanismer.

    Se foreksempel blåklokken:

    Den som vokser i fjellet har dobbelt så mange kromosomer som den som vokser i lavlandet. Fenotypen er ikke synlig endrett fordi man har doblett den informasjone som allerede var der.

    Forøvrig kjenner jeg ikke til noen eksempler som har endrett fenotypen til det ugjenkjenneligge. Det er her vi er uenige. Jeg mener det er en grense for mye endring som kan forklares ut fra darwinistiske prosesser, mens dere tror at darwinistiske mekanismer kan forklare all biologisk informasjon på planeten med et utspring fra gråstein. (ps her kommer hjelpehypotesen RNA verden inn for å dekke over det umuligge)

  • Sigve Brekke

    Jeg legger ut linken om metamorfose igjen fordi den viser hvilke problemer man står over. Hvorfor skulle tilfeldige mutasjoner lede til at en larve plutselig pakket seg inn i en pupp?

    http://www.youtube.com/watch?v=AZk6nZGH9Xo

    At vi har ulike fasonger av sommerfugler kan derimot skylder darwinistiske mekanismer!!

    Jeg mener altså at informasjonen har en intelligent opprinnelse, modifikasjoner over tid etter skapelse er en endring som skjer på informasjon som allerede finnes.

    Tror man på darwinismen tror man ikke bare på et etablert teori, men også på ateistisk filisofi. Å være teist virker for meg mer adekvat i dag en noen gang siden 1859.

  • Sigve Brekke

    filosofi*

  • Yngve B

    @ Sigve: Det at du «ikke kjenner til noen eksempler som har endret fenotypen til det ugjenkjennelige» betyr ikke noe annet enn at du ikke har satt deg inn i problemet. At du finner eksempler der endring i genene ikke fører til endret fenotyp springer jo imot det du hevder tidligere med at all søppelDNA har vist seg å ha funksjoner. Hva er det som er så utrolig med at litt forandring per generasjon ganget med en million generasjoner faktisk fører til stor forandring?

    RNA-verden er ikke en hjelpehypotese for evolusjon ved naturlig utvelgelse. Evolusjonsteorien fordrer at det er noe som formerer seg og at avkommet ikke alltid er 100% identisk med opphavet. Dette benekter du jo ikke. Tidligere i diskusjonen føler du deg latterliggjort når jeg snakket om en intelligens/gud som fikler med skapelsen. Du erkjenner og at vi har funnet masse fossiler. Stoler du på dateringen av disse fossilene? Hvis du stoler på dateringen av fossilene så må jo det bety at du tror at denne intelligensen bak ID faktisk har skapt nye arter med varierende mellomrom. Du må også godta at de nye artene ligner veldig på de gamle artene. Hvorfor er ikke dette en fiklete gud som har gjort det? Det er ikke akkurat en særlig økonomisk eller elegant teori.

  • Doremus

    «Tror man på darwinismen tror man ikke bare på et etablert teori, men også på ateistisk filosofi.»

    Dette er faktisk – unnskyld uttrykket – sludder. Det finnes utallige troende – deriblant paven og hans likesinnende – som utmerket fint kombinerer sin religiøse tro med å «»tro på Darwinisme,»» (ja, det er lagt på et ekstra sett med anførselstegn.) Strengt tatt sier vel heller ikke evolusjonsteorien noe om hvordan det første livet oppsto, bare om hvordan det utviklet seg derfra. Sånn sett kan en «darwinist» endog mene at Gud skapte det første encellede livet og så tok en pause inntil livet hadde utviklet seg nok til å motta en sjel.

    Som ikke-troende skal jeg kanskje være forsiktig med å uttale meg om hva som er naturlig religiøs tankegang, men jeg må si at jeg stusser litt over de som med henvisning til livets fantastiske kompleksitet automatisk hopper til en slutning om at alt dette må følge av en direkte inngripen fra Skaperen. Er det ikke et mye STØRRE vitnesbyrd om Guds storhet hvis han har klart å skape et univers med tilhørende naturlover som kan stå og putre og gå helt på egenhånd i 13 milliarder år, og som HELT UTEN ytre påvirkning klarer å frembringe vesener som lager katedraler, romskip og symfonier?

    Jeg mener…hvem ville du gitt en vitenskapskonkurransepris til – han som lager et spisebord ut av en fem meters trestamme, eller han som lager en maskin som får en trestamme matet inn og spytter ut et fiks ferdig spisebord?

  • Sigve Brekke

    Det stemmer at jeg ikke tror at litt forandring i mange nok generasjoner, ikke fører til fundamentale endringer.

    Jeg stoler grovt sett på dateringene

    Jeg utelukker ikke at skapelse kan ha skjedd flere ganger opp gjennom tiden (det blir en annen ID hypotese og en annen diskusjon)

    For å forstå hvorfor jeg mener hva jeg mener må man forstå informasjonsbegrepet og sette det i sammenheng til informasjonen man finner i DNA. Så versegod her er en repetisjon av begrepet informasjon:

    http://www.evolutionnews.org/2012/01/information_wha055411.html

  • Halvard

    @Sigve
    Dette er hvordan William A. Dembski, Senior Fellow – CSC Discovery Institute definerer Intelligent Design.

    Intelligent design is just the Logos theology of John’s Gospel restated in the idiom of information theory
    http://touchstonemag.com/archives/issue.php?id=49

    Og du mener at det er vitenskap. Intelligent Design er kreasjonisme og ikke noe annet.

  • Yngve B

    @Ali:

    Igjen unnlater du å ta hensyn til den ikke-tilfeldige komponenten «naturlig utvalg». Hadde en genetisk kode kun handlet om et tilfeldig sammensatt sett av AGCT der hver hadde 25% sjanse for å opptre så hadde du kanskje hatt noe å komme med. Så lenge DNA koder for bestemte fenotyper og naturen luker ut fenotyper som ikke når opp i konkurransen så går det ikke an å si noe a priori om den relative hyppigheten av hver bokstav, AGCT.

    @Sigve:

    Om skapelsen har skjedd flere ganger er ikke en annen diskusjon. Det er samme diskusjonen. Hvis evolusjonsteorien er riktig trenger man bare å forklare hvordan livet oppstod én gang. Hvis din versjon av såkalt ID er riktig så må du forklare hver eneste nye og utryddede art separat. Du mener det er en intelligens, men så lenge du ikke kan peke på hvem denne intelligensen er, så har du ikke forklart noe som helst. Hele ID-hypotesen (om den fortjener en så opphøyd tittel) blir fullstendig ad hoc. Det finnes ingen beviser (evidens) for at livet har blitt skapt mange ganger, men tonnevis med bevis for at evolusjon foregår.

  • Sigve Brekke

    Nå dukket argumente om tonnevis av bevis opp igjen, tror nok du må være villig til å skjønne informasjonsbegrepet før du kan noe som helst sjangs til å overbevise meg om at jeg tar feil.

    Man har tonnevis av bevis. jeg gir et eksempel på hvordan disse bevisene kan villede.

    Dyrenes likhetstrekk (Homologi) peker på felles opprinnelse, felles opprinnelse peker på homologi, homologi peker på felles felles opprinnelse, felles opprinnelse peker på homologi, homologi peker på felles opprinnelse……osv.

    Likheter i DNA sekvensen peker på felles opphav, felles opphav peker på likheter i DNA sekvensen, likheter i DNA sekvensen peker på felles opphav, felles opphav peker på likheter i DNA sekvensen……osv

    Dette kan beskrives som sirkelargumentasjon!!

  • Yngve B

    Hvis dyr har felles opphav så vil man forvente likhetstrekk mellom dyr. Man vil også forvente at arter som skilte lag lenger tilbake i tid vil ha større forskjeller. Dette er nøyaktig det man observerer. Derfor kan observasjonene brukes til å underbygge hypotesen om felles opphav.

    Dette er ikke sirkelargumentasjon. Dette er prediksjon som verifiseres av observasjon, mao hele grunnlaget for vitenskapen. Hvis du ikke godtar dette så inviterer jeg deg til å forkaste all annen naturvitenskap samtidig. Så kan vi jo se hvor skikket du er som naturfaglærer etter det.

  • Yngve B

    Det største problemet til ID som gjør at det aldri kan bli en vitenskap er at det ikke er mulig å predikere noe på bakgrunn av hypotesen. Så lenge man ikke kan studere intelligensen som blir postulert så kan man ikke falsifisere hypotesen. Ingen observasjon kan noensinne tale for eller mot hypotesen.

  • N.A

    For dem som vil stifte nærmere bekjentskap med en av Sigves «helter», så finnes det en debatt mellom Dembski og Christoffer Hitchens på nettet.

    http://www.youtube.com/watch?v=D6K43WSZrmI

    Som andre har påpekt fremstår ikke Dembski primært som seriøs vitenskapsmann, men heller som en dypt troende kristen.

  • Yngve B

    Ja, hvis ID er vitenskap, hvorfor er det ikke noen ID-studier i den fagfellevurderte literaturen?

  • Anna

    Ha ha Doremus – endelig en som har sett verden utenfor boblen. Selvsagt er det ingen motsetning mellom å være kristen og å «tro på evolusjonen» og «darwinismen»som sjargongen her uttrykker det. Selvsagt har ikke paven og hans like noen motforestillinger mot «darwinismen», evolusjonsteorien, vitenskap i det hele. Og hvorfor skulle de nå det? Kirken var med på å finne opp naturvitenskapen, Kirken utviklet de første universitetene i verden, noen av de mest prestisjetunge universitetene i verden i dag er drevet av katolske ordener, i Oslo sitter en ung katolsk nonne som deltar i CERN forskningen. ol. osv. etc.

    Get real.

  • Bjørn Ove Sætre

    Dette utdraget fra Demskis bok om Inteligent design sier vel det som trengs:

    «My thesis is that the disciplines find
    their completion in Christ and cannot
    be properly understood apart from
    Christ. . . . The point to understand
    here is that Christ is never an addendum
    to a scientific theory but always a
    completion.»

    http://en.wikiquote.org/wiki/William_A._Dembski

  • Sigve Brekke

    He he he

    Legger merke til at man har gått over til å kritisere de som tror på ID og ikke ID i seg selv. Vell vell, da får jeg legge inn linken til informasjonsbegrepet igenn. Kos dere!!

    http://www.evolutionnews.org/2012/01/information_wha055411.html

    Når det gjelder å kritisere mannen og ikke ballen så kan jeg i samme slengen vise til Richard Dawkins som ble utnevnes til æresdoktor ved Universitetet i Oslo.

    Han er en glødende ateist og har blant annet uttalt at en elev sløver ned sitt intellekt gitt at han har en tro. Dette forekommer i norske læringsresurser på nett.

    Han er kanskje mest kjent for sitt ateistiske budskap, som foreksemel i boken: The God Delusion

    At han ble æresdoktor er fint det, men det sier også at vitenskapen er sammensatt av ulike mennesker med ulik motivasjon. Å kritisere deres bakgrunn blir hvertfall bomskudd.

  • Yngve B

    Uten å prøve å gjøre dette til en «min helt er bedre enn din helt»-diskusjon så vil jeg påpeke noe: Dawkins’ uttalte motivasjon er at han forsøker å forstå naturen og at den forståelsen har brakt ham til ateisme. Dembski sin uttalte motivasjon, som referert av Bjørn Ove, er å få naturen til å passe med Jesus. Forskjellen er vesentlig. Men for at ikke dette skal bli en Ateisme/Religionsdebatt i annen enn indirekte grad, så setter jeg over til katolikken Ken Miller (obs! to timer med info basert i god vitenskap): http://www.youtube.com/watch?v=AK0CYZvaJLw

  • eirik

    @
    «Han er en glødende ateist og har blant annet uttalt at en elev sløver ned sitt intellekt gitt at han har en tro. Dette forekommer i norske læringsresurser på nett.»

    Det er jo riktig at det *kan* være tilfellet. Troen din har jo ført til at du bekjenner deg til pseudovitenskapen ID, oppfjollet kreasjonisme.

    Det hadde vært opplagt også for deg hvis du ærlig hadde spurt deg selv spørsmålet fra Yngve B.:

    «Ja, hvis ID er vitenskap, hvorfor er det ikke noen ID-studier i den fagfellevurderte literaturen?»

  • http://karsteneig.no Karsten Eig

    @Ali:

    Du fortsetter å demonstrere at du ikke forstår evolusjon.

    Husk at det første aksiomet for evolusjonsteorien er at mutasjonene forekommer tilfeldig, det vil si at man skulle forvente at A, C, G og T utgjør ca. 25% hver av strengen. (…) Det hjelper ikke at man sier at seleksjonen ikke er tilfeldig, for så lenge som man sier at mutasjonene er tilfeldige, og at det er like stor sannsynlighet for en A, C, G eller T, så vil hver og en av disse bokstavene utgjøre ca. 25% av strengen.

    Aksiomet – eller snarere observasjonen! – er at mutasjonene skjer tilfeldig, ikke at de bevares tilfeldig. Hver mutasjon som skjer vil være tilfeldig, men så lenge seleksjonen ikke er tilfeldig vil de «ønskede» mutasjonene bli bevart. Man vil derfor ikke forvente at fordelingen av A, C, G, T trenger å være lik.

    Det andre aksiomet til evolusjonsteorien sier at seleksjonen er ikke-tilfeldig, og at “godt DNA” derfor blir bevart. Men så lenge som man postulerer at mutasjonene er tilfeldig, så kan jo en tilfeldig mutasjon like gjerne ødelegge “godt DNA” som “dårlig DNA”. Jeg vil ikke ta utregningene her, fordi det vil antagelig kjede de fleste, men når man begynner å regne på sannsynlighetene her, så ser man at det overveiende antall mutasjoner vil være negative eller i beste fall nøytrale for organismen. Det er også dette man ser i praksis: Mutasjoner fører til at organismen degenerer, og IKKE til at organismen forbedres.

    Selvsagt kan en mutasjon være dårlig. Men fordi den er dårlig vil den minke sannsynligheten for at organismen overlever og reproduserer. En god mutasjon øker sannsyligheten. Derfor vil en dårlig mutasjon i naturen overleve kun i noen få slektsledd (med mindre organismene lever beskyttet), mens en god mutasjon vil spre seg. Selv om et flertall av mutasjonene er nøytrale eller negativevil altså de gode forplante seg.

    Påstanden om at mutasjonen kun observeres til å føre til degenerering er standard kreasjonistprat. Fail. Det mest kjente eksemplet på det motsatte er bakterier som utvikler antibiotikaresistens. Svært nyttig for bakterien, men ille for oss.

    @Sigve Brekke:

    Jeg noterer meg at du fortsatt ikke har besvart min påpeking av at du tok feil mht den kambriske «eksplosjonen» og de påstått manglende overgangsfossilene. I stedet tar du en Gish Gallop og kommer med nye argumenter om sommerfuglmetamorfose – nok et kjent og kjært gud i hullene-kreasjonistargument av typen «argument fra uvitenhet».

    Jeg er hverken biolog eller insektekspert, men det tar meg fem minutters googling å finne noen mulige svar på metamorfosen. Svaret ligger sannsynligvis i at den utviklingen alle organismer går gjennom fra fosterstadiet (også et menneske er jo bare en liten celleklump i begynnelsen) til voksent individ hos insektene er flyttet ut av egget, slik at larven rett og slett er et insektsfoster som utvikler seg videre før den blir voksent. Årsaken er kanskje at man dermed unngår at larver og voksne kjemper om det samme matfatet.

    http://evolutionwiki.org/wiki/Butterfly_metamorphosis_is_too_complex_to_have_evolved

    http://evolutionwiki.org/wiki/Evolution_can%27t_explain_butterfly_evolving_from_caterpillar

    http://madsci.org/posts/archives/jun2000/960566507.Ev.r.html

    Jeg skal ikke påstå at dette er Svaret med stor S, men det viser at argumentet fra kreasjonistenes side koker ned til et god in the gaps-argument.

  • http://karsteneig.no Karsten Eig

    Jeg er enig med Sigve Brekke i at en persons tro i utgangspunktet ikke er relevant for å diskutere om vedkommendes påstander om forskning stemmer. Det er mange kristne forskere. Men ID er i en særstilling fordi hele motivasjonen for ID, som klart vist av flere her, og som Discovery Institute er helt ærlige om i «wedge-dokumentet» er å få vitenskapen til å skulle passe med religionen. De starter med religion, og bruker skohornet for å skvise vitenskapen inn i den. Når svaret er gitt på forhånd er det ikke lenger vitenskap.

    Forøvrig er jeg også enig i at Dawkins er en glimrende evolusjonsforsker og vitenskapsformidler – men en elendig historiker og han burde slutte å snike inn angrep på religion i utide.

  • Sigve Brekke

    Personlig mener jeg at mye av argumentasjonen til darwenister lukter vel så mye av Darwin in the gap som God in the gap. Jeg mener at Gud ikke er i hullene, men manifisterer seg i det man kan forstå. Darwinistene henviser til darwinistiske prosesser og nok tid, og konstruerer en logisk oppfatning rundt disse prosessene.

    Jeg mener også at den vitenskapligge metode er en god og nøytral metode som gir objektive svar, men det er tolkningen av dataene som er ulik. Jeg tolker jo ikke dataene innefor det eksisterende paradigme, men infører informasjonsteori som en del av tolkningen og da kommer jeg ikke utenom at et intellekt kan ha stått bak.

    Den vitenskapligge metoden er bra den, jeg har ikke til hensikt å undergrave metoden, men jeg spør hva er den beste forklaringen på de observasjonene man ser?

  • Yngve B

    Men du forklarer jo ikke noen observasjoner. Du sier jo bare «her er noe jeg ikke liker forklaringen på, ergo er den laget av en intelligens (i.e. Jehova).»

    Hvilken av disse er intelligent designet? http://3.bp.blogspot.com/–EK6aNdlVOw/TaR3LrYeBAI/AAAAAAAAABM/0yxsHMMw-fk/s1600/Gaudi%2BTermite.jpg Høyre eller venstre?

  • Sigve Brekke

    Jeg liker spørsmålet ditt fordi det er en ID problemstilling.

    Utgangshypotesen min er at høyre må komme av en intelligent kilde

    Så kan man jobbe videre med den…..

  • Yngve B

    Slutt å ignorere det som går imot hypotesen din. Prøv på nytt.

  • Yngve B

    Mao. du må argumentere for hvorfor dette skulle være utgangshypotesen utifra ID.

  • http://karsteneig.no Karsten Eig

    Darwinistene henviser til darwinistiske prosesser og nok tid, og konstruerer en logisk oppfatning rundt disse prosessene.

    I tillegg til alle fossilene, genetikk, observasjoner av artsdannelse….

    Jeg mener at Gud ikke er i hullene, men manifisterer seg i det man kan forstå.

    Alt du hittil har henvist til dreier seg om å peke på at noe er svært komplisert, gjerne mer komplisert enn det man trodde før. Og siden det fyller oss med ærefrykt og vi ikke vet (enda) hvordan det er blitt til, bruker du Gud som forklaring på det. Dvs Gud i hullene.

  • John Galterud

    Det relevante spørsmålet til Sigve Brekke er: hvilke beviser har du for at du for at jorden ble skapt for 6000 år siden?

    Neivel, du mener jorden er eldre? (C14 osv) I så fall tror du ikke på det gamle testamentet som er det eneste argumentet for «intelligent design».

    Javel, du mener at GT tar feil, men at IM likevel er kompatibel med at verden er 6 milliarder år? Vær snill og presenter 5 milliarder år gamle menneske-fossiler (100 millioner år gamle godtas også).

  • Bjørn Ove Sætre

    En sak som jeg tror vil være av interesse for denne diskusjonen.

    http://www.vl.no/samfunn/lege-nektet-jobb-pa-grunn-av-sin-tro/

    For ordens skyld, jeg mener det er uakseptabelt at man blir nektet en stilling på grunn av sitt livssyn, men har likevel full forståelse for at en arbeidsgiver i en vitenskapelig institusjon har visse reservasjoner i slike saker. Som andre har bemerket på denne siden, ville du ansett en historielærer som benekter holocaust?
    Eller ansette en astrofysiker som tror på astrologi. Eller en geolog som tror at jorden er 6000 år gammel.

  • Sigve Brekke

    Jeg har også skrevet i kronikken at jeg forstår reaksjonen til arbeidgiver, men jeg er ikke enig i at man skal reagere slikt. Første gang jeg hørte om disse tankene følte jeg meg truet selv om jeg såg på meg selv som religiøs. Det tok litt tid, men etterhvert oppdaget jeg at jeg trodde på evolusjonsteorien uten å ha satt meg inn i hva jeg egentlig trodde på.

    Legg merke til i diskusjone over hvor redde man er for informasjonsbegrepet. Så lenge man får bestemme hvilke begrepsapparat som er gyldig i diskusjonen har man høy selvtillitt på å vinne argumentene, men når jeg snakker om biologisk informasjon så tørr man ikke være like selvsikre.

    http://www.evolutionnews.org/2012/01/information_wha055411.html

  • http://karsteneig.no Karsten Eig

    @John Galterud:

    Brekke har gjort det klart at han i hovedsak(?) holder seg til etablerte dateringer. Og han har ikke trukket inn C14 (som pga en halveringstid på 5730 år uansett er irrelevant for geologisk tid). Jeg synes ikke vi skal tillegge ham argumenter han ikke bruker.

  • eirik

    Såvidt jeg forstår (han har vært unnvikende, for å si det pent) argumenterer Brekke for at evolusjon har funnet sted, men ikke gjennom naturlig utvalg, men utfra intelligent design. Dvs. at vårt tidlige felles opphav var programmert til å til slutt resultere i mennesker.

    Forstår jeg riktig da?

  • Sigve Brekke

    Jeg tror at arter kan tilpasse seg miljøet, men at det finne en grense for hvor mye endring som kan skje tilfeldig. For meg er det uklart hvor den grensen går, men kanskje man kan bruke informasjonteori til å sannsynliggjøre en hypotetisk grense.

    Dermed tror jeg at endring kan skje gjennom naturlig seleksjon, men er svært kritisk til at denne endringsmekanismen kan forklare alt det biologiske livet på planeten med utspring fra gråstein.

  • eirik

    Jeg skal forsøke å overse at du igjen drar frem abiogenese.

    Tror du at homo sapiens sapiens ble «skapt» ferdig for 2 millioner år siden? Eller tror du at homo sapiens sapiens har eksistert hundre av millioner av år, eller kanskje bare noen tusen år?

  • Sigve Brekke

    Tidaspektet er jeg helt likegyldig til, men går gjerne i den retningen bevisene fører meg. Selv om man hadde hatt sikre bevis på at menneske utviklett seg fra en felles stamfar/stammor (likestilling) med apekattene ville ikke det falsifisert ID, ID er ikke religion!!

    Ut fra det vi vet i dag har jeg ingen grunn til å mene at mennesket stammer fra apekatter: Se linken under

    http://www.youtube.com/watch?v=Se-5QFsT15Y

    Man kan jo lure på hvorfor vi mennesker er i stand til å bedømme rett og galt, drive med kunst,musikk, vitenskap, idrett, matematikk, filosofi, religion…..

    Jeg finner bedre svar i min kristne tro på spørsmål som omhandler meningen med livet. De som fonekter en mulig skaper og er naturalister må tro at man kommer fra ingenting, av ingenting, for ingenting.

  • Arcus

    «Ut fra det vi vet i dag har jeg ingen grunn til å mene at mennesket stammer fra apekatter»
    Mennesker stammer IKKE fra apekatter, men vi har felles stamfar. For å illustrere: Du stammer ikke fra din tremenning, men dere har en felles stamfar.

    PS: Herr Wells er ikke bare kreasjonist, han er også AIDS fornekter. Ganske grumsete kilder du benytter. Merk også at boken videoen referer er et av de sentrale bevisene i Dover saken, der ID ble sidestilt med kreasjonisme og er dermed ansett som religion og ikke vitenskap.

  • John Galterud

    Karsten Eig:

    Hvis jorden er 6000 år blir C14 relevant likevel. Argumentet ditt besvarte jeg i det forrige innlegget mitt, men igjen: om han innrømmer at det gamle testamentet sin beskrivelse av jordas skapelse ikke stemmer (i og med at han innrømmer at jorden er eldre), raser jo også bibelens teori om kreasjonisme sammen. Enten er historien sann, eller så er den ikke det.

  • http://karsteneig.no Karsten Eig

    @John Galterud:

    Det finnes forskjellige typer kreasjonister. Alt fra de som tar Bibelen bokstavelig, til de som holder på mainstream geologi og biologi, men mener at Gud har programmert det hele. Brekke ser ut til å falle et sted i mellom, når han i hovedsak (hva det skal bety) holder seg til mainstream datering. Inntil Brekke evtentuelt begynner å kritisere geologien synes jeg vi skal la det ligge.

  • http://karsteneig.no Karsten Eig

    Icons of Evolution bygger på en intellektuelt uærlig blekke som er behørlig omtalt her: http://www.talkorigins.org/faqs/wells/

    Videoen med Wells er stråmannsarumentasjon og løgner fra ende til annen.

    Hvis skillet mellom aper og mennesker var så klart, hvorfor klarer ikke kreasjonistene å bli enige om hva som er hva? http://www.talkorigins.org/faqs/homs/compare.html

  • http://karsteneig.no Karsten Eig

    @Sigve Brekke

    Jeg er ikke redd for informasjonsbegrepet, men en video på over en time må man ha tid til å se. Setter derfor pris på om du har noen linker til skriftlige artikler om dette.

  • N.A

    Mange gode innlegg her, og Sigve du er argumentativt kraftig på minussiden.

    Men det er et spørsmål, som jeg ikke kan se har blitt berørt.

    Sigve, hvis ID teorien er korrekt, at vi står overfor intelligent design av en antatt allmektig skaper, så burde vi forvente perfekte konstruksjoner. Men det påfallende ved selv de mest komplekse og imponerende konstruksjoner i naturen er imidlertid det motsatte, de bærer stort sett alle preg av svakheter og mangler. Dette gjelder ikke minst øyet, som mange ID propagandister har løftet frem som «bevis» for sin teori.

    Hermann von Helmholz, 1800-tallets banebrytende synsforsker og optikkpioner, ga følgende vurdering av hvor intelligent designet til menneskets øye er:

    ”If an optican wanted to sell me an instrument which had all these defects, I should think myself justified in blaming his carelessness in the strongest way, and giving him back his instrument”

    Min øyelege, som også er professor I øyemedisin, svarte følgende på mitt spørsmål om det konstruksjonsmessige forbedringspotensialet:

    ”Øyet er et imponerende organ, men det er åpenbart et forbedringspotensiale. Personlig har jeg i hvertfall en håndfull forbedringsforslag, som jeg er sikker på ”vår skaper” ville akseptert dersom det var han som var konstruksjonsansvarlig”

    Grunnen til den allestedsnærværende konstruksjonsmessige impefeksjon lar seg godt forklare gjennom evolusjonsteorien. Sigve på den annen side må hevde at vi har å gjøre med en allmektig skaper som bedriver slurvete konstruksjonsarbeid. Sigve hvordan forklarer ID teorien dette?

    Alternativt til ID kan vi utmerket benytte evolusjonsteorien. En instruktiv beskrivelse av hvordan evolusjonsteorien forklarer ”øyet”, er gitt av Richard Dawkins i ”Climbing Mount Impropable” kapittel 5. Anbefales.

  • Sigve Brekke

    Karsten Eig, jeg kan ikke tro annet enn at du verken har lest boken eller omtalen av boken som du henviser til siden du sier:

    «Videoen med Wells er stråmannsargumentsjon og løgn fra ende til annen.»

    Selv om du kanskje har skummet gjennom omtalen fra dine likesinnede har du vell kanskje ikke lest boken?

    I omtalen som du henviser til står det blant annet:

    «In the case of Haeckel, though, I have to begin by admitting that Wells has got the core of the story right. Haeckel was wrong. His theory was invalid, some of his drawings were faked, and he willfully over-interpreted the data to prop up a false thesis. Furthermore, he was influential, both in the sciences and the popular press; his theory still gets echoed in the latter today. Wells is also correct in criticizing textbook authors for perpetuating Haeckel’s infamous diagram without commenting on its inaccuracies or the way it was misused to support a falsified theory».

  • John Galterud

    Jeg ser ikke hvorfor vi som tror på evolusjon skal komme så på defensiven i slike diskusjoner. Hvorfor ikke be kreasjonistene om hvilke beviser de har for påstandene de kommer med? Hvor er fossilene som beviser at menneskene levde sammen med tyrannosaurus rex?

    Det eneste «beviset» for kreasjonismen er det gamle testamentet. Men siden C14-dateringer beviser at jorden er mer enn 6000 år gammel, ser vi at denne boken bare er fantasi.

  • Halvard

    @Sigve
    Hvorfor bruker du saa og si bare kilder fra Discovery Institute? Det er tross alt en kreasjonistisk think tank.

  • Cassanders

    @Sigve Brekke.
    ————————————–Beginquote
    ..
    Man kan jo lure på hvorfor vi mennesker er i stand til å bedømme rett og galt, drive med kunst,musikk, vitenskap, idrett, matematikk, filosofi, religion…..
    ————————————–Endquote

    Igjen et «argument from incredulity».

    Innenfor en biologisk forståelsesramme er ikke dette spesielt vanskelig.
    Hovedpoenget er at vi(H. sapiens) gjennom evolusjonshistorien har utviklet oss som et sosialt dyr med kompliserte OG særdeles plastiske interaksjoner. Evne til å tolke, forstå og vurdere vilje til samarbeid (deteksjon av samarbeid OG snyting) har gitt større overlevelse.
    For en gjennomgang av «bevissthet» og «intensjonalitet» se f.eks Dennett.

    Du finner en god popularisert gjennomgang av grunnlaget for våre «moralske fakulteter» hos primatologen F. De Waal (f,eks «Good natured») og hos Matt Ridley («On the origins of Virtue»).

    Spekteret av sosiale interaksjoner har ytterligere blitt øket ved utvikling av språk.
    Våre evner til å løse abstrakte oppgaver (som f.eks matematikk) er (hyggelige) adaptive følger av de sosiale egenskapene som har vært selektert for.

    Cassanders
    In Cod we trust

  • Yngve B

    Denne diskusjonen har bar forsterket mitt inntrykk av at det er viktig å stille krav til at lærerne i skolen er i stand til å gjøre rede for fagene de skal undervise i. En naturfaglærer med så slett forhold til både hva vitenskapen viser oss og til grunnleggende kildebruk som Sigve Brekke her har vist, ville jeg forsøkt å holde mine (hypotetiske) unger langt borte fra. En norsk-lærer som ikke forstår og/eller tror på evolusjonsteorien er ikke et stort tema for meg. En naturfaglærer slipper ikke så lett unna.

    Sigve Brekke sier at han godtar vitenskapelig datering, men er ikke villig til å diskutere hvilken innvirkning dette har på tesen hans. Han sier at han godtar mikroevolusjon, men ikke makroevolusjon uten å på noen som helst måte ha argumentert for hvorfor det er et skille mellom disse, eller for den saks skyld hva det er som opprettholder dette skillet. Han er heller ikke villig til å diskutere hvordan man skal klare å skille mellom det som er intelligent designet og det som bare tilsynelatende er det. Han sier det er manglende overgangsfossiler, men er ikke villig til å diskutere hva som skal til for at et hull mellom to fossiler og deres innbyrdes forskjeller er fylt. Han ønsker å snakke om informasjon uten å klare definere hva som skal menes med dette, eller hvordan man skal måle om det er mer informasjon tilstede i ett genom enn et annet. Han snakker om abiogenese som om det har noe som helst med evolusjonsteorien å gjøre. Han snakker om kompleksitet som indikerende intelligent design uten å forklare hvorfor kompleksitet ikke kan oppstå uten hjelp av en intelligens. Han snakker om kompleksitet uten å innse at en intelligent designer vil forsøke å lage designet sitt så enkelt som overhodet mulig. Kompleksitet er med andre ord en dårlig indikator på intelligent design. Han bruker Discovery Institute som sin fremste kilde i debatten, en organisasjon som aldri har utført noe forskning og som ikke en gang har klart å foreslå en måte å utføre forskning på ID, men som likevel hevder det er vitenskap de holder på med. Han tar tilsynelatende Ali’s torturerte forståelse av sannsynlighetsregning i forhold til evolusjon for god fisk, noe som gir meg inntrykk av at det ikke bare er naturfagsundervisnin, men også matematikkundervisning Sigve bør skjermes fra.

    Dette er bare noen av punktene som står uten underbyggende argumenter fra Sigve Brekkes side. Jeg har ingen tro på at han kommer til å skifte mening i denne saken basert på denne diskusjonen, men jeg har så langt deltatt for å forsøke å få Sigve til å måtte argumentere for hvorfor han mener det han mener. Han har istedet svart ved å kontinuerlig flytte målstengene for diskusjonen. Jeg syns jeg og andre har fått frem hvor dårlig fundamentert Sigve sin argumentasjon er og setter derfor punktum for min del av diskusjonen.

  • Sigve Brekke

    Til Cassanders: For meg høres det ut som man konstruerer en masse med ateistisk filosofi

    Til John og Halvard: Dere avslører at dere ikke har peiling på hva ID er for noe siden dere hele tiden faller tilbake til at det må være kreasjonisme. Uansett hva dere tror så er jeg ikke kreasjonist.

  • Cassanders

    @Sigve Brekke

    For meg høres det ut som man konstruerer en masse med ateistisk filosofi

    Det var da et underlig utsagn !!?

    Mener du at «ateistisk filosofi» er konstruert i motsetning til deistisk/teistisk filosofi?

    Eller mener du kvaliteten på «ateistisk filosofi» på noe vis skulle være dårligere enn evt deistisk/teistisk filosofi?

    Er det kanskje mengden du ikke bifaller? :-)

    Det er for så vidt greit å vite hva du synes du hører, og hva du mener, men det kunne være interessant å se om du hadde noen slags argumenter å komme med.

    Cassanders
    In Cod we trust

  • eirik

    Jeg tror han mener at vitenskap er ateistisk fordi magi ikke tas i betraktning.

    @ Sigve: Du har faktisk ikke forklart hva du mener med ID, og de forskjellige ID’ere har svært forskjellig oppfatning.

    At du hevder at liv er intelligent designet, mener kreasjonister også.

    Men innebærer din form for ID at mennesker, st bernhardshunder og dinosaurer levde samtidig for noen hundre millioner år siden, at jorden er 5 mrd år, og universet 13,7 mrd?

    Eller mener du at alle forskjellige skapninger har blitt designet ferdig på forskjellige punkter i historien, slik at f. eks. dinoer ble skapt for noen hundre millioner år siden, mennesker ble skapt ferdig for 1 million år siden, mens st. bernhardhunder ble skapt for 500 år siden, osv. som sammenfaller med de tidspunktene som evolusjonsbiologer idag slutter seg til?

    Dette vil jo innebære at du postulerer millioner forskjellige tidspunkter for design. Hva er hypotesen din?

  • Bjørn Ove Sætre

    Fant dette på verdidebatt:

    “En telling viser at det blant 480.000 amerikanske vitenskapsfolk finnes ca. 700 som mener kreasjonisme er troverdig rent vitenskapelig, altså teorien om at komplekse livsformer ikke har utviklet seg, men “plutselig har dukket opp”.

    Kan ikke stå inne for at de talla stemmer, men la oss anta at de gjør det. 700 av 480 000 er cirka 0,15%. Dvs 99,85% av disse vitenskapsfolka er uenige med deg i ditt syn på ID. Dette sier selvsagt ikke noe om sannheten av evolusjonsteorien, men:

    Sigve: har du tenkt over hvorfor så mange er uenige med deg? Du må gjerne leve i den tro at det foregår en gigantisk konspirasjon innen vitenskapen for å undertrykke sannheten slik du ser det, men har du vurdert muligheten for at du rett og slett tar feil? Hvorfor en slik skråsikkerhet?

  • Sigve Brekke

    Et sted må man starte, før i tiden trodde alle at jorden var i sentruma av universett. Bevisbyrden er desverre hos det etablerte. Etter denne debatten håper jeg å ha fått frem:

    - Det finnes mye ateistisk filosofi blant det som kalles vitenskap
    - Kontroversielle meninger kan føre til diskriminering på grunn googel, kritne må derfor holde seg lavt.
    - Evolusjonsteorien forklarer ikke alt like bra som mange mener
    - Det må være lov å undervise i evolusjon selv om man ikke tror den er sann
    - Mange tror ID er kreasjonisme, men faktum er at det er forskjellige syn
    - Et teistisk verdensbilde kan begrunnes rasjonelt
    - Mange i denne debatten har vist at det finnes mang intollerante holdninger der ute
    - Til slutt, hadde disse tankene bare vært svada tror jeg mange ikke hadde sett seg brye med å debatere, men mange kastet seg utpå med mer eller mindre gode argumenter.

    Avslutter med denne:

    http://www.youtube.com/watch?v=T7m9yjCSXwM&feature=youtu.be&fb_source=message

  • N.A

    Sigve:

    Denne debatten tapte du på alle punkter.

    Oppsummeringen din av debattens resultat, viser det samme som din evne til å veie foreliggende bevis for evolusjon vs. ID, – svært dårlig dømmekraft.

    Debatten viser også at det er grunn til bekymring i forhold til hva slags undervisning dine elever vil motta i naturvitenskapelige fag. Skole, foreldre og elever har grunn til å være bekymret.

    Derimot virker du rimelig kvalifisert til å undervise på søndagsskoler, bedehus og lignende.

  • Doremus

    @Sigve:

    «Til slutt, hadde disse tankene bare vært svada tror jeg mange ikke hadde sett seg brye med å debatere, men mange kastet seg utpå med mer eller mindre gode argumenter.»

    Der kom den, ja. «Folk bruker tid på å argumentere mot meg, altså må det være noe i det jeg sier.» (For ordens skyld, den siste setningen står altså i hermetegn og ikke sitattegn.)

    Du mener altså at den beste måten for folk å vise at de synes du serverer svada er å ignorere nevnte svada og ikke bruke tid på å kommentere det.

    Greit, jeg skal følge oppfordringen.

  • Biolog

    Dette begynner i grunnen bare å bli pinlig, Sigve. Håper du klarer å komme deg ut av det en dag. Se gjerne på troende Ken Miller sitt foredrag om ID. http://www.youtube.com/watch?v=JVRsWAjvQSg

  • Bjørn Ove Sætre

    Er enig med Biolog her. Sigve kan nok slippe unna med sitt uvitenskapelige syn hvis han hadde jobbet på en ungdomskole, men å jobbe som naturfag/biologi/geofag lærer i videregående……..da treffer du mest sannsynligvis på folk (Cand. scient’er og Cand Real’er…..) som vil riste på hodet av dine argumenter. Sannsynligvis vil de ikke en gang gidde å diskutere fag med deg fordi, som mange av oss etterhvert har skjønt; å diskutere evolusjon med kreasjonister er bortkastet tid. Jeg skjønner at amerikanske vitenskapsfolk føler seg tvunget å gjøre det. Her i Europa er vi heldigvis forskånet for dette. Se bare hvordan norske biologiprofessorer i stor grad ignorerer professor Peder Tyvand, Norges mest høyrøsta kreasjonist, (han er fysikk professor ved UMB), Legg merke til hvordan Tyvand reagerer; reinspikka konspirasjonstenking fra ende til annen. Blir ikke overasket om han stikker innom her snart og utfordrer oss til debatt. Ikke la dere friste folkens!

  • http://karsteneig.no Karsten Eig

    @Sigve Brekke:

    Jeg skrev ikke at hele boka til Wells var stråmannsargumentsjon og løgn fra ende til annen. Jeg skrev at den aktuelle videoen om mennesket og aper var det, og det står jeg ved. Jeg står også ved at boka til Wells er en intellektuelt uærlig blekke. Til tross for at jeg, ganske riktig, ikke har lest den. Hvordan tør jeg si det? Fordi jeg har en faglig bakgrunn (geologi med en del paleontologi) for å si det, og fordi jeg har studert kreasjonisme som fenomen like lenge som jeg har studert geologi. Da ser man fort at den del argumenter går igjen; den kambriske eksplosjonen, manglende overgangsfossiler, Archaeopteryx er en fugl, bakterieflagellen, øyets utvikling etc etc. Når Wells tar for seg noen av disse trenger man derfor bare overflatekunnskap for å se hvor det bærer. Jeg kjenner lusa på gangen.

    Og noen korte bemerkninger til dine avsluttende punchlines:

    - Det finnes mye ateistisk filosofi blant det som kalles vitenskap

    Ikke som du har påvist.

    - Kontroversielle meninger kan føre til diskriminering på grunn googel, kritne må derfor holde seg lavt.

    Det du kaller diskriminering er stort sett å bli møtt med motargumenter til religiøst baserte påstander. Det kalles ytringsfrihet.

    - Evolusjonsteorien forklarer ikke alt like bra som mange mener

    Det er mye vi ikke vet enda, men du har ikke demonstrert noen eksempler på at ID skulle gjøre det bedre. Fordi ID ikke er en forklaring, det er en erstatning for en forklaring.

    - Det må være lov å undervise i evolusjon selv om man ikke tror den er sann

    Enig. Hvordan du ville takle den voldsomme kongnitive dissonnansen det måte medføre er din sak, og jeg har vansker for å se hvordan du kan undervise med noe særlig entusiasme. Men i prinsippet er jeg enig; man skal ikke nektes med mindre man ikke gjør jobben sin.

    - Mange tror ID er kreasjonisme, men faktum er at det er forskjellige syn

    ID er kreasjonisme i ny innpakning, og baserer seg stort sett på de samme argumentene og samme logiske tankemønster: Finn et reellt eller påstått problem med evolusjonen, og putt gud i hullet.

    - Et teistisk verdensbilde kan begrunnes rasjonelt

    Filosofisk kanskje, men ikke noe av det du har levert.

    - Mange i denne debatten har vist at det finnes mang intollerante holdninger der ute

    Nå skal jeg være litt hard. Evolusjonen er en meget godt bevist vitenskapelig teori. Jeg vil gå så langt som til å si at å fornekte at evolusjon er et faktum – ikke at den er svaret på alt, men at den skjer og generelt kan forklare livets mangfold – er å stikke hodet i sanden og fornekte virkeligheten. Da må du tåle motargumenter.

    - Til slutt, hadde disse tankene bare vært svada tror jeg mange ikke hadde sett seg brye med å debatere, men mange kastet seg utpå med mer eller mindre gode argumenter.

    Mer klassisk kreasjonistretorikk: Hvis vi debatterer med dere anerkjenner vi at det er noe i det. Hvis vi holder kjeft og later som ingenting betyr det at vi er redde for dere fordi vi innerst inne vet at kreasjonister har rett. Damned if you do, damned if you don’t – et logisk ugyldig argument.

  • Pingback: Aftenposten: Toleranse og vitenskapelighet | Torbjørn Røe Isaksen - konservativ.no

  • Pingback: Kreasjonister i plenen | Karsten Eig

  • Lektor’n

    Selvsagt kan lærere tro hva de vil, dvs. de kan utmerket ha sine hoder fylt av både den ene og den andre typen vrangforestillinger, all den tid dette ikke går i praksis utfordrer læreplanen.

    Hva gjelder de muslimske legestudentene Isaksen i sin kronikk refererer til, burde disse nektes å jobbe som leger, nettopp fordi de jo påstår at religion trumfer årsaksrekker kartlagt av vitenskapen; m.a.o. påstander om verden som kan testes. Dette er jo testbart, så hva man kunne gjøre er å ta disse religiøse fanatikerne på alvor og deportere dem til verdens mest ødeliggende sted, uten hjelpemidler og se hvor langt de kom uten bruk av vitenskapelige metoder.

    Grunnen til at religiøse og spesielt muslimer, kan ture frem som de gjør, er fordi ingen setter foten ned. Ta f.eks. flomkatastrofen i Pakistan nylig; selv ville vi ikke løftet en finger for å hjelpe dem. All den tid de tror det finnes noe som heter Allah, og som de skriker på i tide og utide, får de ikke et rødt øre fra oss. De får klare seg selv, for enten tar man troen sin på alvor eller så gjør man ikke det.

    Her er en link til en bok som viser hvordan religion fører til mental lidelse:

    http://www.amazon.com/RELIGION-ETIOLOGY-ILLNESS-Henry-Jones/dp/0615138446
    Her er innholdsfortegnelsen:
    SECTION I: THE HEALTHY MIND
    Ch. 1. Anatomy of the human brain
    Ch.2. The Human Forebrain
    SECTION II
    Ch.3. Religion
    Ch.4. Indoctrination
    Ch.5. Perversion and Motivation
    Ch.6. The ’Religious Self’
    Ch. 7 Redemption
    Ch. 8. The Dialectic Effect
    Ch. 9. Perversion of Cognition
    Ch. 10. Identiy
    SECTION III
    Ch. 11. Psychiatric Symptoms
    Ch. 12. Development of Mental Illness
    Ch. 13. The Psychiatric Syndromes
    Depression
    Bipolar Disorder
    Alcohol Abuse
    Chemical Abuse
    Obsessive-Compulsive
    Panic Disorder
    Post-Traumatic Stress Disorder
    Schizophreniform Disorders
    Somatization Disorders
    Sexual & Identity Disorders
    Ch. 14. Examples of Religious Self-Sacrifice
    Ch.15 Religious Self-Sacrifice in Everyday life
    SECTION IV
    Ch. 16. Morality and Animal Behavior
    Ch. 17 The Cure of Mental Illness
    Ch. 18. The Morality of Life and Mental Health
    Ch. 19 The Prevention of Mental Illness
    Ch. 20 The Purpose of Mental Illness
    Ch. 21. Politics and Public Policy
    Ch. 22: Summary.

  • Egil Brekke

    Det er med dyp sorg jeg meddeler at min kjære storebror Sigve Brekke døde i sin leilighet denne uken. Han vil bli svært savnet..

    «Kom til meg, alle dere som strever og bærer tunge byrder, og jeg vil gi dere hvile»